recovering storage cells from loss of a system volume using cellboot rescue
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
Ngày tải lên :
30/03/2014, 13:20
... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were ... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used...
- 10
- 696
- 0
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pptx
Ngày tải lên :
20/06/2014, 04:20
... 102(7):256-8 13 National Patient Safety Agency: National Reporting and Learning System Patient safety incident reports in the NHS: NRLS Data summary National Reporting and Learning System Data Summary 2009 ... work: An exploration of organizational and psychological factors constraining safety in the operating room Qual Saf Health Care 2006, 15(3):165-70 Tucker AL, Spears SJ: Operational Failures and ... effect and escalating into more serious breakdowns is an essential characteristic of a reliable process It requires a focus on the adequacy of the organisational defenses that remain in reserve and...
- 7
- 443
- 0
báo cáo hóa học:" Can the surgical checklist reduce the risk of wrong site surgery in orthopaedics? - can the checklist help? Supporting evidence from analysis of a national patient incident reporting system" pdf
Ngày tải lên :
20/06/2014, 07:20
... 102(7):256-8 13 National Patient Safety Agency: National Reporting and Learning System Patient safety incident reports in the NHS: NRLS Data summary National Reporting and Learning System Data Summary 2009 ... work: An exploration of organizational and psychological factors constraining safety in the operating room Qual Saf Health Care 2006, 15(3):165-70 Tucker AL, Spears SJ: Operational Failures and ... effect and escalating into more serious breakdowns is an essential characteristic of a reliable process It requires a focus on the adequacy of the organisational defenses that remain in reserve and...
- 7
- 507
- 0
Tài liệu World Bank, Inter-American Development Bank, and Subregional Development Banks in Latin America: Dynamics of a System of Multilateral Development Banks ppt
Ngày tải lên :
16/02/2014, 06:20
... Republic, Trinidad and Tobago, Uruguay, and Venezuela); CABEI in Belize, Costa Rica, the Dominican Republic, El Salvador, Guatemala, Honduras, Nicaragua, Panama; and Argentina and Colombia outside ... countries of the Latin America and Caribbean region; the CAF in 16 countries (Argentina, Bolivia, Brazil, Chile, Colombia, Costa Rica, Ecuador, Jamaica, Mexico, Panama, Paraguay, Peru, Dominican Republic, ... subregion, and; CDB in Anguilla, Antigua and Barbuda, the Bahamas, Barbados, Belize, British Virgin Islands, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St Kitts and Nevis, St Lucia, St...
- 35
- 481
- 0
báo cáo sinh học:" Forecasting the need for medical specialists in Spain: application of a system dynamics model" potx
Ngày tải lên :
18/06/2014, 17:20
... variables depict the rates of change of levels, such as the number of training positions that are available Stocks are accumulations of flows, and are calculated mathematically as the integration ... and causal links A causal link connects a cause variable with an effect variable by a link with a positive or negative charge A positive link from variable X to variable Y means either that X adds ... population growth rate of the European Union, with an average annual increase of 1.6% and a Page of total increase of 15%, leading to a great increase in the need for health services, particularly...
- 9
- 543
- 1
báo cáo hóa học:" Neuronal transcription factor Brn-3a(l) is over expressed in high-grade ovarian carcinomas and tumor cells from ascites of patients with advanced-stage ovarian cancer" ppt
Ngày tải lên :
20/06/2014, 07:20
... interpretation of data, drafting and revising the manuscript AL and CBR assisted with experiments, interpretation of data and manuscript preparation JFK and MAQ assisted in the interpretation of data ... high-grade ovarian carcinomas and tumor cells from ascites of patients with advanced-stage ovarian cancer Journal of Ovarian Research 2010 3:17 Submit your next manuscript to BioMed Central and take full ... Scientific, MA, USA) and re-probing the membrane with b-actin primary antibody (Sigma-Aldrich, Sydney, Australia) Statistical analysis Statistical analysis of the extent of Brn- 3a( l) immunostaining...
- 12
- 267
- 0
Báo cáo hóa học: " Multiple-Clock-Cycle Architecture for the VLSI Design of a System for Time-Frequency Analysis" doc
Ngày tải lên :
22/06/2014, 23:20
... SUB ParADD1 Datab[] Result[] LPM ADD SUB Dataa[] OutREG Data[] LPM DFF Cout Result[] LPM ADD SUB (Parallel adders) ParADD1 a1 [19 0] a1 [19 18] GND LPM CLSHIFT a1 [17 0] Data[] Result[] Distance[] ... the IEEE Transactions on Image Processing He is a Member of the Yugoslav Engineering Academy, and a Member of the National Academy of Science and Art of Montenegro (CANU) Professor Stankovi´ is ... units are realized by using combinational logic, meaning that all calculation operations are performed in parallel The schematic diagram of its FPGA implementation is given in Figure 12 As seen,...
- 18
- 385
- 0
Báo cáo y học: " Osteolytic bone destruction resulting from relapse of a testicular tumour 23 years after inguinal orchiectomy and adjuvant chemotherapy: a case report" pot
Ngày tải lên :
11/08/2014, 14:20
... 5th and 10th year after primary treatment with a calculated annual risk of 1% In two patients, late relapse occurred later than 10 years One of these patients presented with metastatic seminoma, ... [3] Of the 81 patients treated at the University of Indiana for late relapse of germ cell tumours, 60% showed late relapse more than five years after primary therapy and complete remission [3] A ... 1984, the patient’s histopathology revealed a mixed tumour, a choriocarcinoma and an embryonic carcinoma, with retroperitoneal and pulmonary metastases To treat this, an orchiectomy was performed,...
- 4
- 294
- 0
Báo cáo y học: "Evaluation of a system of structured, pro-active care for chronic depression in primary care: a randomised controlled trial" potx
Ngày tải lên :
11/08/2014, 16:22
... II; DSM IV: Diagnostic and Statistical Manual of Mental Disorders, 4th edition; WASAS: Work and Social Activity Scale; SAPAS: Standardised Assessment of Personality - Abbreviated Scale; CSRI: Client ... cost-effectiveness analysis using this outcome Planned analyses All data will be double entered, using a reputable data entering service, blind as to participant group A description of baseline characteristics ... which are measured at baseline and at the end of follow-up, will be analysed using analysis of covariance (ANCOVA) to adjust for any differences in baseline values [33] Results will be presented as...
- 9
- 320
- 0
Báo cáo y học: "Global expression changes resulting from loss of telomeric DNA in fission yeast" pps
Ngày tải lên :
14/08/2014, 14:21
... 5'-GTACTGGTAGTCCTCTGATGTATGGG-3' P3': 5'-ATGCCCCGTACGCTTATCTA-3' and 5'-TTTGCCTTTCTAGCCCATGA-3' Pdh: 5'-CAACACCAATACTGACGATGATG-3' and 5'-GCAATAGAACCAGCGGTTTG-3' Primers for centromeric dh repeats have been ... medium was made at the start of the study and used to culture all cells analyzed by microarrays to prevent batch-to-batch medium variations that might yield artifactual microarray results interactions ... microarray analysis that detected the 3' end of the forward transcript (Figure 7a) The reverse strand was weakly detectable in cells from days and of the growth curve (Figure 7a) dsRNA arising from...
- 15
- 259
- 0
The introduction of a system that would improve a manager’s ability to successfully supervise their employees, operating companies has been identified as a solution
Ngày tải lên :
17/01/2016, 19:35
... ability of using the database Two tier applications have a same scenario with this content The name of this kind of the application is a client-server application In this type of application all ... different approaches that can be taken to create the system these are: A windows application would run as a programme directly on the user‟s machine The application can easily be connected to a database ... through Visual studio allowing the system to update and modify the data from within the database A login system can also be created by using data in the database where the login details will be...
- 31
- 448
- 0
Báo cáo " Calibration and verification of a hydrological model using event data " ppt
Ngày tải lên :
22/03/2014, 12:20
... table 2.2 Table 2.1 NAM parameter explanation and boundaries NAM Parameter NAM Parameter Description Unit Umax Lmax CQOF CKIF CK1,2 TOF TIF TG CKBF Maximum water content in surface storage Maximum ... from measurable quantities of basin characteristics [6] and hence model calibration is needed Using the observed rainfall and evaporation data of each storm event as inputs, model will automatically ... verification procedure introduced above, Gia Vong – a river basin in Quang Tri was taken as a case study (Figure 3.1) The basin has an area of about 275 km2, a perimeter of 111.9 km and an average...
- 11
- 440
- 0
Title: The Autobiography of a Journalist, Volume II pdf
Ngày tải lên :
23/03/2014, 05:20
... take, and it was evident that it had become a mania closely resembling insanity Buchanan's criticism had a rancor and breath of personality in it which had no excuse; it was a savage, wanton attack ... roadstead, and, taking passage on the Italian postal steamer to Ancona, I was obliged, on landing, to make another term of two weeks in the lazaretto, though we had again a clean bill; and, on arriving ... We had not lain a day at the anchorage when the fright of the Corfiotes at our proximity, as great as if we had the plague on board, caused a popular demonstration against us, and the health-officer...
- 119
- 335
- 0
Source investigation of a small event using empirical Green’s functions and simulated annealing ppt
Ngày tải lên :
23/03/2014, 13:20
... effective active area on the fault This gives us values of the average total slip of between 0.1 and cm and a stress drop of between I and 10 bar for a rise time equal to At, and a stress drop that can ... scale For each of the two possible fault planes, the active fracture area has a different shape Fig shows a rupture propagation towards the north-north-east for the two fault planes The shape and ... of solution, and also the uncertainties contained in the data itself, we propose the decreasing of the temperature to a critical value equal to the noise variance of the data This value is calculated...
- 13
- 486
- 0
improving near field confinement of a bowtie aperture using surface plasmon polaritons
Ngày tải lên :
06/05/2014, 08:53
... is adaptive with a smallest grid size of nm in critical areas Material properties are obtained from Ref 18 A 30-nm-width slit in a 100-nm-thick aluminum film on a quartz substrate is illuminated ... phase modulation when the wave propagates to and reflects from the groove A close examination of Fig 2͑b͒ indicates that SPP waves are excited at the edges of each groove and stronger fields are ... for Al/air interface At these periodicities, the grooves produce standing waves matching the SPP wavelength Superposition of these standing waves and the emerging field at the slit leads to a narrower...
- 3
- 347
- 0
báo cáo hóa học:" Identification of a biomarker panel using a multiplex proximity ligation assay improves accuracy of pancreatic cancer diagnosis" doc
Ngày tải lên :
18/06/2014, 15:20
... that are increased as well as those that are decreased in the plasma of patients displaying clinical symptoms of pancreatic cancer In this study, we assembled a cohort of 52 cases of locally advanced, ... Figure CEA and CA125 are significantly prognostic for advanced, unresectable pancreatic cancer CEA and CA125 are significantly prognostic for advanced, unresectable pancreatic cancer (A) Kaplan-Meier ... unresectable, advanced pancreatic cancer as well as a cohort of 43 healthy, age-matched volunteers After calculating log2 PLA units for each tumor marker within each sample (Materials and Methods),...
- 12
- 450
- 0
Báo cáo hóa học: " Modeling Nonlinear Power Amplifiers in OFDM Systems from Subsampled Data: A Comparative Study Using " potx
Ngày tải lên :
23/06/2014, 01:20
... ´ [13] M L´ zaro, I Santamar a, C Pantaleon, A Mediavilla, a ı ´ A Tazon, and T Fern´ ndez, “Smoothing the canonical a piecewise-linear model: an efficient and derivable large-signal model for ... transistors,” IEEE Trans Circuits and Systems I: Fundamental Theory and Applications, vol 48, no 2, pp 184–192, 2001 [14] D Dardari, V Tralli, and A Vaccari, A theoretical characterization of ... nonlinear HPA models have been compared with respect to their in-band and out -of- band performances The comparative study has been carried out using measurements obtained from a GaAs MESFET amplifier,...
- 10
- 265
- 0
Báo cáo vật lý: "Preliminary Studies for Production of Fatty Acids from Hydrolysis of Cooking Palm Oil Using C. rugosa Lipase" pot
Ngày tải lên :
07/08/2014, 14:20
... shows a typical hydrolysis profile of palm oil at temperature of 45ºC for an initial palm oil concentration of 0.1 g palm oil/ml iso-octane at agitation speed of 200 rpm and oil-aqueous ratio of ... 99.84% assay was purchased from Fischer Chemicals (UK) All chemicals are of analytical grade and used without further purification 2.2 Enzymatic Hydrolysis A stoppered 250 ml conical flask was initially ... K.Y., Giridhar, R & Wi, W.T (2006) Application of binary Candida rugosa lipase for hydrolysis of soybean oil J Mol Catal B: Enzym., 42(1–2), 32–38 Al-Zuhair, S., Ramachandran, K.B & Hasan, M (2007)...
- 10
- 419
- 1
Báo cáo khoa học: " Comparison of a small volume of hypertonic saline solution and dextran 40 on hemodynamic alternations in conscious calves" ppsx
Ngày tải lên :
07/08/2014, 18:21
... collection of each blood sample, systolic (SAP), diastolic (DAP) and mean systemic pressure (MAP), mean PAP and CVP, heart rate (HR) and abnormal signs were recorded Immediately after the recording was ... Changes in relative plasma volume (rPV) were calculated from Hb and Ht [18,19] Plasma sodium, potassium and chloride concentrations were analyzed by electrode methods, using an automatic analyzer (Model ... Kazuyuki Suzuki et al kg Healthy calves were selected on the basis of physical examination, electrocardiography and hematological analysis A well-balanced growth diet consisting of pelleted...
- 6
- 366
- 0
Báo cáo nghiên cứu khoa học " Calibration and verification of a hydrological model using event data " pot
Ngày tải lên :
09/08/2014, 17:23
... table 2.2 Table 2.1 NAM parameter explanation and boundaries NAM Parameter NAM Parameter Description Unit Umax Lmax CQOF CKIF CK1,2 TOF TIF TG CKBF Maximum water content in surface storage Maximum ... from measurable quantities of basin characteristics [6] and hence model calibration is needed Using the observed rainfall and evaporation data of each storm event as inputs, model will automatically ... verification procedure introduced above, Gia Vong – a river basin in Quang Tri was taken as a case study (Figure 3.1) The basin has an area of about 275 km2, a perimeter of 111.9 km and an average...
- 11
- 330
- 0