receptors ca2 signaling and synaptic plasticity

Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

Tài liệu Báo cáo khoa học: Dual P2Y12 receptor signaling in thrombin-stimulated platelets – involvement of phosphoinositide 3-kinase b but not c isoform in Ca2+ mobilization and procoagulant activity pdf

Ngày tải lên : 18/02/2014, 16:20
... processes Secreted ADP binds to the P2Y1 and P2Y12 purinergic receptors, and triggers shape change, Ca2+ mobilization and platelet aggregation [13–15] The P2Y1 receptors are linked to Gq, but they ... the Ca2+ response relies on both phospholipase C and PI3-K activity PI3-Kb and not PI3-Kc mediates the P2Y12 effect on thrombin-evoked Ca2+ responses In man and mouse, the PI3-Kb (p110b) and ... ADP-evoked phospholipase C activity and Ca2+ mobilization in a way controlled by PI3-Kb Results Autocrine and added ADP increases and prolongs thrombin receptor-induced Ca2+ responses via P2Y12 receptor...
  • 15
  • 565
  • 0
báo cáo hóa học: "Transcranial magnetic stimulation, synaptic plasticity and network oscillations" potx

báo cáo hóa học: "Transcranial magnetic stimulation, synaptic plasticity and network oscillations" potx

Ngày tải lên : 19/06/2014, 08:20
... principles of synaptic plasticity and local inhibition in the rodent hippocampus before scrutinizing to what extent repetitive TMS might engage cortical synaptic plasticity Synaptic plasticity in ... accepted, however, that TMS involves a range of neuronal processes such as synaptic excitation, synaptic inhibition and synaptic plasticity [2,3,6-9] Moreover, TMS seems to affect circuit-level patterns, ... dendritic shaft and soma Figure gic receptors in a CA1 pyramidal neuron Schematic representation of the glutamatergic and GABAerSchematic representation of the glutamatergic and GABAergic receptors...
  • 10
  • 373
  • 0
Calcium-sensing receptors regulate cardiomyocyte Ca2+ signaling via the sarcoplasmic reticulum-mitochondrion interface during hypoxia/reoxygenation pdf

Calcium-sensing receptors regulate cardiomyocyte Ca2+ signaling via the sarcoplasmic reticulum-mitochondrion interface during hypoxia/reoxygenation pdf

Ngày tải lên : 10/08/2014, 05:21
... the indicator in the absence of Ca2+ and is obtained by adding a solution of 10 mM EGTA for 15 min, and Fmax is the fluorescence of the Ca2+ -saturated indicator and is obtained by adding a solution ... type and type IP3Rs (B) Western blot analysis of cardiomyocyte lysates using antibodies specific for IP3R, type 1, type and type 3, respectively DAPI and FITC to co-stain nuclei and type IP3 receptors ... cardiomyocyte Ca2+ signaling through MAM subjected to CaR activation and H/Re The main findings of this study are as follows: (i) Activation of CaR induced the release of Ca2+ from the SR and, simultaneously,...
  • 11
  • 81
  • 0
Báo cáo y học: " Signaling and regulation of G protein-coupled receptors in airway smooth muscle" ppsx

Báo cáo y học: " Signaling and regulation of G protein-coupled receptors in airway smooth muscle" ppsx

Ngày tải lên : 13/08/2014, 13:20
... guinea pig, and mouse) have been shown to be morphologically and functionally similar to ASM in vivo; they stain for smooth muscle-alpha-actin and myosin heavy chain, and exhibit signaling and functional ... ASM cells possess physiologic levels of most signaling components (e.g., receptors, effectors, and downstream signaling intermediates), yet many signaling pathways are readily characterized with ... A2 / Prostaglandin (TP) receptors) [19], and sphingosine-1-phosphate (SPP) (activating EDG receptors) have been shown to potentiate the mitogenic effects of receptor tyrosine kinase signaling, although...
  • 23
  • 363
  • 0
imidazoline receptors in insulin signaling and metabolic regulation

imidazoline receptors in insulin signaling and metabolic regulation

Ngày tải lên : 13/11/2014, 10:20
... development for hypertension and insulin resistance This thesis focused on the molecular basis for I1-imidazoline binding and cell signaling and the mechanisms linking this signaling protein to regulation ... lacks affinity for I2R Cellular Signaling Mechanisms of I1-imidazoline Receptors The knowledge of I1-imidazoline receptors cell signaling events is still limited and the topic needs more intense ... I1-imidazoline receptor cell signaling pathways because these cells constitutively express I1-imidazoline receptors but not α2-adrenergic receptors, as confirmed with radioligand binding and molecular approaches...
  • 208
  • 146
  • 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: roles in gene expression, hormone signaling and mRNA processing docx

Ngày tải lên : 16/02/2014, 14:20
... and E2F6, MLL2 interacts with E2F2, E2F3, E2F5 and E2F6 [34] Similar to E2Fs, the G1-phase regulator HCF-1 recruits MLL1 and Set1 to E2F-responsive promoters and induces histone methylation and ... DNA-binding domain, a ligand-binding domain and a transactivation domain The DNA-binding domain is responsible for DNA binding specificity and dimerization, and the ligand-binding domain is responsible ... (serine- and arginine-rich proteins) family of splicing factors CAPER, a SR-like protein, interacts with ERa and the progesterone receptor and modulates the ligand-dependent transcription and alternate...
  • 15
  • 607
  • 0
Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

Tài liệu Báo cáo khoa học: Myristoylation of the dual-specificity phosphatase c-JUN N-terminal kinase (JNK) stimulatory phosphatase 1 is necessary for its activation of JNK signaling and apoptosis pdf

Ngày tải lên : 16/02/2014, 14:20
... ⁄ Thr and Tyr residues [18] Several DSPs have been established as MAPK phosphatases that dephosphorylate the Tyr and Thr residues in the activation loop of MAPKs and thereby attenuate signaling ... with endosomal and Golgi structures using specific markers (EEA1, TfnR for endosomes and GM130, TGN46 for Golgi) and found that JSP1-wt partially colocalized with the Golgi apparatus and showed minimal ... wide variety of signaling proteins These hydrophobic modifications can confer reversible association with membranes and other signaling proteins, which modulates the specificity and efficiency of...
  • 11
  • 580
  • 0
Tài liệu Báo cáo khoa học: What MAN1 does to the Smads TGFb/BMP signaling and the nuclear envelope Luiza Bengtsson pdf

Tài liệu Báo cáo khoa học: What MAN1 does to the Smads TGFb/BMP signaling and the nuclear envelope Luiza Bengtsson pdf

Ngày tải lên : 19/02/2014, 02:20
... with cell type and signal-specific transcription activators or repressors There are three classes of Smads: regulatory Smads (BMP-responsive R-Smads 1, and and TGFb-responsive R-Smads and 3), the ... and 3), the coSmad Smad4 and the inhibitory Smads and All R-Smads and the co-Smad consist of three domains: the N-terminal MH1 domain, the variable proline-rich linker, and the C-terminal Mad homology ... were capable of antagonizing TGFb-, BMP- and activin -signaling Similarly, human MAN1 with mutated RR-motif was defective in antagonizing both BMP and TGFb signaling in tissue culture cells [15]...
  • 9
  • 704
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... yeast pheromone and mammalian GPCR signaling pathways In genetically modified yeast strains, the reporter system is activated after receptor–ligand interaction, Ga protein dissociation and activation ... strain induced at 15 °C, and from yeast expressing SSTR2 as a control activity By taking advantage of structural and functional similarities between yeast and mammalian GPCR signaling pathways, this ... TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence of the new insert, as in the case of pJH2-I7 Plasmids pJH2-I7 and pJH2-OR17-40...
  • 14
  • 473
  • 0
Genes and Autoimmunity - Intracellular Signaling and Microbiome Contribution by Spaska Angelova Stanilova pot

Genes and Autoimmunity - Intracellular Signaling and Microbiome Contribution by Spaska Angelova Stanilova pot

Ngày tải lên : 17/03/2014, 21:20
... intracellular sig‐ naling pathway such as TLR signaling pathway, Fc receptors, receptors and ligands of immunological synapses, vitamin D receptors and other immune related genes Two opposite hypothesis ... R, Greenberg, D A, & Davies, T F Common and unique susceptibility loci in Graves and Hashimoto dis‐ 25 26 Genes and Autoimmunity - Intracellular Signaling and Microbiome Contribution eases: results ... use, distribution, and reproduction in any medium, provided the original work is properly cited 34 Genes and Autoimmunity - Intracellular Signaling and Microbiome Contribution and the subsequent...
  • 276
  • 282
  • 0
Báo cáo khoa học: Mitochondrial Ca2+ sequestration and precipitation revisited docx

Báo cáo khoa học: Mitochondrial Ca2+ sequestration and precipitation revisited docx

Ngày tải lên : 23/03/2014, 03:20
... relationship between mitochondrial Ca2+ handling and signal transduction and cell death pathways [9–13], it is imperative to identify the mechanism(s) that define mitochondrial Ca2+ accumulation capacity ... 2010 FEBS Mitochondrial Ca2+ precipitation C Chinopoulos and V Adam-Vizi A B Mito NCX reverse 3Na+ Ca2+ Matrix 3Na+ Ca2+ Matrix Mito NCX forward Fig (A) Fitting of the Ca2+ uniporter model (lines) ... decades and still generate a vast amount of literature The major ‘players’ in Ca2+ uptake and release mechanisms are still unknown: the molecular identities of the uniporter and PTP are unknown, and...
  • 15
  • 294
  • 0
Báo cáo khoa học: Modulation of Ca2+ entry and plasma membrane potential by human TRPM4b pptx

Báo cáo khoa học: Modulation of Ca2+ entry and plasma membrane potential by human TRPM4b pptx

Ngày tải lên : 23/03/2014, 09:21
... (Icrac [14]) A Ca2+ -free ⁄ Ca2+ -readdition protocol was used to distinguish between the release of Ca2+ from intracellular stores and Ca2+ influx across the plasma membrane Whereas Ca2+ release ... Modulation of Ca2+ entry by TRPM4b R Fliegert et al A B Fig Ca2+ release and Ca2+ entry induced by ionomycin in TRPM4b-expressing HEK-293 cells The cells were loaded with Fura2 ⁄ AM, and [Ca2+ ]i was ... Ionomycin releases Ca2+ from intracellular Ca2+ stores and thus induces electrogenic Ca2+ entry across the plasma membrane via the capacitative Ca2+ entry mechanism [14] This Ca2+ entry, either...
  • 10
  • 407
  • 0
Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx

Báo cáo khoa học: Tec family kinases: Itk signaling and the development of NKT ab and cd T cells potx

Ngày tải lên : 28/03/2014, 22:21
... TCR signaling, Itk deficiency may affect the SLP-76 signaling complex and dampen the TCRmediated Ca2+ influx and activation of PLCc1, weakening downstream signals, such as ERK ⁄ MAPK, NFAT and ... cytokines and are defective in cytokine production following Fig Signaling pathway leading to i NKT and NKT-like cd T cells modulated by Itk that results in the development of i NKT ab and shared ... cells and express the CD4 and NK1.1 markers Itk and NKT cd T-cell development Compared with ab T cells, the cd T-cell population is minor, comprising  5–10% of the total T cells in the blood and...
  • 10
  • 454
  • 0
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf

Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf

Ngày tải lên : 29/03/2014, 00:20
... other species (Xenopus, Drosophila, mouse isoforms 1, 2, and 4, rat isoforms and 2, bovine isoforms 1, 2, 3, and 4, and human isoforms 1, 2, 3, and 4) is shown in Fig (lower panel) It is evident that ... additional data linking the lack of a Ca2+ -induced PTP to the ANT and the Ca2+ -Pi precipitation mechanism Specifically: (a) adenine nucleotides decreased Ca2+ uptake rate and capacity – the effect of cATR ... ANT ligands on Ca2+ uptake capacity in Artemia mitochondria (A) Reconstructed time courses of extramitochondrial [Ca2+ ] calculated from CaGr-5N fluorescence Mitochondria were added at 50 s, and this...
  • 15
  • 505
  • 0
Báo cáo khoa học: Membrane compartments and purinergic signalling: P2X receptors in neurodegenerative and neuroinflammatory events pdf

Báo cáo khoa học: Membrane compartments and purinergic signalling: P2X receptors in neurodegenerative and neuroinflammatory events pdf

Ngày tải lên : 30/03/2014, 02:20
... immunological evidence for the presence of and role for P2X7 receptors also in neuronal functions and injury Given the general widespread and abundant occurrence of P2X receptors in the nervous system, ... release ATP and respond to extracellular nucleotides that, for example, induce migration and initiation of the phagocytotic process ATP acting on microglia, and particularly on P2X4 and P2X7 receptors, ... CNS, and then to progress to a chronic phase in which oligodendrocytes, myelin and axons degenerate is MS, causing numerous physical and mental symptoms and often progressing to physical and cognitive...
  • 11
  • 352
  • 0
GENES AND AUTOIMMUNITY - INTRACELLULAR SIGNALING AND MICROBIOME CONTRIBUTION docx

GENES AND AUTOIMMUNITY - INTRACELLULAR SIGNALING AND MICROBIOME CONTRIBUTION docx

Ngày tải lên : 30/03/2014, 09:20
... intracellular sig‐ naling pathway such as TLR signaling pathway, Fc receptors, receptors and ligands of immunological synapses, vitamin D receptors and other immune related genes Two opposite hypothesis ... R, Greenberg, D A, & Davies, T F Common and unique susceptibility loci in Graves and Hashimoto dis‐ 25 26 Genes and Autoimmunity - Intracellular Signaling and Microbiome Contribution eases: results ... use, distribution, and reproduction in any medium, provided the original work is properly cited 34 Genes and Autoimmunity - Intracellular Signaling and Microbiome Contribution and the subsequent...
  • 276
  • 446
  • 0
Báo cáo Y học: Inhibition of SERCA Ca2+ pumps by 2-aminoethoxydiphenyl borate (2-APB) 2-APB reduces both Ca2+ binding and phosphoryl transfer from ATP, by interfering with the pathway leading to the Ca2+-binding sites ppt

Báo cáo Y học: Inhibition of SERCA Ca2+ pumps by 2-aminoethoxydiphenyl borate (2-APB) 2-APB reduces both Ca2+ binding and phosphoryl transfer from ATP, by interfering with the pathway leading to the Ca2+-binding sites ppt

Ngày tải lên : 31/03/2014, 23:20
... on Ca2+ ion binding and dissociation These values are presented as means ± SEM Data presented is a result of an average of 10–12 individual experiments Experiment kobs(s)1) Ca2+ Ca2+ Ca2+ Ca2+ ... affinity of Ca2+ binding and phosphoryl transfer and postulate that the drug binds to and interferes with the Ca2+ entry pathway of the Ca2+ -ATPase MATERIALS AND METHODS 2-Aminoethoxydiphenylborate (diphenylboric ... M H3PO4, and left to dry, then placed in scintillant and counted physics, model SX17 MV) as described by Longland et al [13] Briefly, the sample handling unit possesses two syringes, A and B (drive...
  • 10
  • 412
  • 0
unsicker - cell signaling and growth factors in development

unsicker - cell signaling and growth factors in development

Ngày tải lên : 03/04/2014, 12:05
... Cell Signaling and Growth Factors in Development Edited by K Unsicker and K Krieglstein © 2006 WILEY-VCH Verlag GmbH & Co Part I Cell Signaling and Growth Factors in Development Cell Signaling and ... Mammals have four Notch receptors encoded by four different genes Notch receptors are activated by Deltalike ligands (Dll–1, –3, and –4) and Serrate-like ligands (Jagged–1 and –2) presented by neighboring ... Secretary Heidelberg) and to Dr Andreas Sendtko and the Wiley team for having initiated and promoted the project Heidelberg and Göttingen September 2005 Klaus Unsicker and Kerstin Krieglstein...
  • 1.1K
  • 320
  • 0
metal toxicity in plants perception, signaling and remediation

metal toxicity in plants perception, signaling and remediation

Ngày tải lên : 29/05/2014, 17:23
... coordination and storage of phosphate and metals such as Zn, Mg, and K in vacuole and cytoplasm and also in the detoxification of Cd has been widely suggested (Van Steveninck et al 1992; Hayden and Cobbett ... it and its quick turnover and utilization for the other thiol ligands and proteins Acidic amino acids, glutamic acid (Glu) and aspartic acid (Asp), provide an extra carboxyl group (ÀCOOH), and ... localization and presence of major metal-binding ligands in a model plant with a standard root, stem and shoot system In each organ, tissues and cells are conventionally divided into apoplasic and symplastic...
  • 275
  • 341
  • 0