recent studies in a scid mouse model

... were always assayed at the same time and in the same way All samples were always determined in triplicate and in a blind fashion Immunoblot analysis An aliquot of brain homogenates was electrophoresed ... outlined anatomical area in the image, as previously described [9,16,17] Analyses were always performed in a coded fashion Statistical analysis Data are expressed as mean ± standard error of mean ... this AD-like brain A amyloidosis model Previously, we have shown that a full dose of indomethacin alone despite a significant reduction in brain inflammation had only a marginal effect on brain...

Ngày tải lên: 19/06/2014, 22:20

... PUBLICATION AND PRESENTATIONS Characterization of human umbilical cord lining derived epithelial cells and transplantation potential Zhou Y, Gan S U, Lin G, Lim Y T, Masilamani J, Mustafa F, Phua ... therapeutic application of cord lining cells in ex vivo insulin gene therapy using a streptozocin (STZ) induced type diabetic mouse model Chapter Literature Review All organ and cell transplantation ... calf serum FITC fluorescein isothiocyanate Foxp forkhead box protein GLM general linear model GM-CSF granulocyte-macrophage colony-stimulating factor H&E hematoxylin and eosin HBSS Hank’s balanced...

Ngày tải lên: 11/09/2015, 10:02

... (1997) alpha-Galactosidase A deficient mice: a model of Fabry disease Proc Natl Acad Sci USA 94, 2540–2544 Chiba Y, Sakuraba H, Kotani M, Kase R, Kobayashi K, Takeuchi M, Ogasawara S, Maruyama Y, Nakajima ... Fabry mouse; (C, D) lung – epithelial cell staining increased in Fabry mouse; (E, F) brain microvascular endothelial staining in Fabry mouse Magnification ·16 no VT1 staining of normal brain (Fig ... 7F) In Fabry brain, extensive staining of the microvasculature is evident (Fig 7E) The arachnoid membrane surrounding the brain is extensively stained in Fabry but not normal mouse brain Although...

Ngày tải lên: 19/02/2014, 07:20

... histological examination tumors were explanted, fixed in 4% formalin and embedded in paraffin Hematoxylin/Eosin staining of slices was performed according to standard protocols All animal protocols ... of Gd-BOPTA was increased according to dosage applied in men (0.1 mmol/kg) Animals were anaesthetised via i.p application of ketamine/xylazine mixture prior to imaging Body weight was assessed ... GNU Image Manipulation Program (GIMP 2.6.8) and calculating the area using formula A = a/ 2 × b/2 × π Results Imaging of organs and tumors; gadobenate dimeglumine (Gd-BOPTA) induced MRI contrast...

Ngày tải lên: 10/08/2014, 10:21

... not part of the training data for official MUC-6 evaluation) This model gave 68.0 F1 and is labeled +DRYRUN-TRAIN in table 2 (a) We then added the ACE ENGLISH-NWIRE training data, which is from a ... measure Vilain et al (1995) The table in (a) is our performance on the thirty document MUC-6 formal test set with increasing amounts of training data In all cases for the table, we are evaluating on ... JMLR Pascal Denis and Jason Baldridge 2007 Global, joint determination of anaphoricity and coreference resolution using integer programming HLT-NAACL Thomas Ferguson 1973 A bayesian analysis...

Ngày tải lên: 08/03/2014, 02:21

Ngày tải lên: 15/03/2014, 14:20

... relevant features (such as L-marking, Case, and 0) If we adhere to the representational paradigm used above, we can define Chains in the following manner: Chain Schevaa Node: C-Node: {Cat,Level,Pos,ID,Ftrs} ... a particular representation provides a formal characterisation of locality Just as phrase structure is defined in terms of branches, we can define Chains as a sequence of links More specifically, ... structures are limited to some combination of binary (non-terminal) and unary (terminal) branches As discussed above, we can characterise the representational framework in terms of nodes and schemas:...

Ngày tải lên: 18/03/2014, 02:20

... variable, and thrice continuously differentiable in space variable, with bounded related spatial partial derivatives Note that these assumptions cover typical financial applications In particular, ... 4.1 are applicable to a CB also in the case of a positive call notice period, since, in the Markovian model of the present paper, a CB may always be interpreted as an RB 4.3 Numerical Analysis ... the variational inequalities and the doubly reflected BSDEs 3.3 Variational Inequalities Approach In Section 3.3, we will give analytical characterizations of the so-called pre-default clean prices...

Ngày tải lên: 22/03/2014, 20:20

... (ECB) and Katerina Šmídková (Czech National Bank) are workstream coordinators Xavier Freixas (Universitat Pompeu Fabra) acts as external consultant and Angela Maddaloni (ECB) as Secretary The ... (known a priori with certainty at the aggregate level), and all of them insure fully against that risk by paying the appropriate premium to the bank, the spread will also contain the default insurance ... In the case of capital, firms are financing its purchase by participating in the bond market, where funds can be raised at the real rate r Moreover, the capital depreciates at an annual rate δ Consequently,...

Ngày tải lên: 29/03/2014, 06:21

... well as a signal attenuating extracellular signal-regulated kinase [23] This is in accordance with the lack of aberrantly enhanced extracellular signal-regulated kinase signaling in pancreatic tumors ... Biochemical characterization of endogenous carbohydrate-binding proteins from spontaneous murine rhabdomyosarcoma, mammary adenocarcinoma, and ovarian teratoma J Natl Cancer Inst 73, 1349–1357 ´ Andre ... a tumor suppressor and lectin ⁄ glycan remodeling as an effector pathway, especially by examining clinical samples, is clearly justified Examining galectin expression in clinical samples of pancreatic...

Ngày tải lên: 29/03/2014, 21:20

... Similarity in a Taxonomy: An Information-Based Measure and its Application to Problems of Ambiguity in Natural Language In Journal of Artificial Intelligence Research, 11:95-130, 1999 Beatrice Santorini ... Similarity is measured based on matching POS tags, matching words and a thesaurus-based measure of semantic similarity In both the discriminative reranker of Ratnaparkhi et al (1994) and that of ... matching Automatically eliminating such examples is a simple method of cleaning the data Experimental Evaluation We use a parsing model similar to that described in (Hogan, 2005) which is based on...

Ngày tải lên: 31/03/2014, 01:20

... Sclafani RA, Agarwal R: Resveratrol causes Cdc2-tyr15 phosphorylation via ATM/ ATR-Chk1/2-Cdc25C pathway as a central mechanism for S phase arrest in human ovarian carcinoma Ovcar-3 cells Carcinogenesis ... hydroxyl-radical scavenging and a novel, glutathione-sparing mechanism of action Arch Biochem Biophys 2000, 381:253-263 de la Lastra CA, Villegas I: Resveratrol as an anti-inflammatory and anti-aging agent: ... plasma membrane rafts present in most cells, and were first characterized morphologically as small flask-shaped plasma membrane invaginations [18] The typical caveolin-1 (CAV1) protein is a principal...

Ngày tải lên: 18/06/2014, 15:20

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 18/06/2014, 22:20

... mg/kg) was administered to animals, and saline diluent (negative control) was administered to animals Antiviral drug was administered in a single dose, via intraperitoneal route, 24 hours after ... infecting the fetus, inducing disease and mortality, following experimental inoculation of pregnant guinea pigs Maternal and fetal GPCMV disease and mortality was abrogated by antiviral therapy ... Hartley guinea pigs were purchased from Harlan Laboratories (Indianapolis, IN) and confirmed to be GPCMV-seronegative by ELISA assay Guinea pigs were housed in an AALAC-accredited vivarium, and...

Ngày tải lên: 19/06/2014, 08:20

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 20/06/2014, 04:20

... mg/kg) was administered to animals, and saline diluent (negative control) was administered to animals Antiviral drug was administered in a single dose, via intraperitoneal route, 24 hours after ... infecting the fetus, inducing disease and mortality, following experimental inoculation of pregnant guinea pigs Maternal and fetal GPCMV disease and mortality was abrogated by antiviral therapy ... Hartley guinea pigs were purchased from Harlan Laboratories (Indianapolis, IN) and confirmed to be GPCMV-seronegative by ELISA assay Guinea pigs were housed in an AALAC-accredited vivarium, and...

Ngày tải lên: 20/06/2014, 04:20

... Figure A Material Testing Machine A Material Testing Machine (Autograph, Shimadzu, Kyoto, Japan) load frame was mounted on the flat of polymethyl methacrylate surface on the metacarpal bones of each ... the load-time curve [7] Gap closing data was recorded using a digital video camera (Digital Movie Camera DMX-HD, Sanyo Ltd, Osaka, Japan) After testing, distal radial bones, fixation plates and ... loading of the distal radius across the intact wrist joint at full wrist extension (A) A standardized 3-part intraarticular and severe comminuted fracture was simulated by making a 1-cm transverse...

Ngày tải lên: 20/06/2014, 04:20

... Figure A Material Testing Machine A Material Testing Machine (Autograph, Shimadzu, Kyoto, Japan) load frame was mounted on the flat of polymethyl methacrylate surface on the metacarpal bones of each ... the load-time curve [7] Gap closing data was recorded using a digital video camera (Digital Movie Camera DMX-HD, Sanyo Ltd, Osaka, Japan) After testing, distal radial bones, fixation plates and ... loading of the distal radius across the intact wrist joint at full wrist extension (A) A standardized 3-part intraarticular and severe comminuted fracture was simulated by making a 1-cm transverse...

Ngày tải lên: 20/06/2014, 07:20

... grew as allografts in C57BL/6 TgMISIIRTAg-Low mice (Figure 6, Table and data not shown) producing disseminated peritoneal adenocarcinoma frequently accompanied by intrabursal and intra-ovarian ... dye-excluding ovarian carcinoma side population (SP), a potential population of ovarian cancer initiating cells, was identified in MOVCAR cell lines [48] Ovarian tumors arising in C57BL/6 TgMISIIR-TAg-DR26 ... Hanash S, Misek DE, Katabuchi H, Williams BO, et al: Mouse model of human ovarian endometrioid adenocarcinoma based on somatic defects in the Wnt/ beta-catenin and PI3K/Pten signaling pathways...

Ngày tải lên: 20/06/2014, 07:20

... variable rather than as a parameter This is the standard approach used in a two-fast/one-slow variable analysis In all three panels of Fig 13 parameters are set at gBK = 0.4 nS, Cm = 10 pF, and ... concentration was treated as a fixed parameter and the second slow variable (in addition to the variable n used here) was an inactivation variable for an A- type K+ current In the current paper, we again focused ... Journal of Mathematical Neuroscience (2011) 1:12 Page of 23 Fig (a) Pseudo-plateau bursting in a GH4 pituitary cell line (b) Plateau bursting in a neonatal CA3 hippocampal principal neuron Reprinted...

Ngày tải lên: 20/06/2014, 22:20