read write head on the surface of a magnetic disk

... massless Dirac cones at the K and K valleys Another essential difference is connected with spin-related properties In the surface, Hamiltonian of the 3D TI σ acts on the real spin of the charge carriers, ... In addition, changing the length of the barrier and/or the magnetic field can tune the total reflection and the perfect transmission regions We also examined the electron transmission through a ... If the incident electrons are spin polarized along the direction of the vector (π × z), the magnetic field bends the trajectory of the electrons, resulting in a rotation of the spin of the transmitted...

Ngày tải lên: 20/06/2014, 20:20

... influences of H on the Ag adsorption at a Si(111)-7 surface, we first calculate the adsorption energies of Ag atom at the high coordination sites on the clear and 19H-Si(111)-7 surfaces, because all the ... the main surfactant during the heteroepitaxy of the metals on Si surfaces When H interacts with Si surface- dangling bonds, this will cause the relaxation of the surface bond strain and reduce the ... adsorbed by H The charge around the H atom at the Si adatom removes toward the adsorbed Ag atom and forms a covalent-like Ag-H bond Due to the charge transfer from the H to the Si adatom on the...

Ngày tải lên: 22/06/2014, 00:20

Ngày tải lên: 08/08/2014, 21:20

... time variation of solar radiation and average temperature of the present experimental study in August and the theoretical results of [1] in June Figure 10 The time variation of solar radiation and ... time variation of the parameter “average temperature/solar radiation” for August from the present study and the published data [1] for June Figure 14 The time variation of the parameter “average ... vertical layer of water along the tank wall Part of this heat is then transferred by diffusion towards the core of the tank The water of the vertical layer becomes lighter than its surrounding and then...

Ngày tải lên: 05/09/2013, 15:28

... knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does not consist of the processing of information or data, since the obtaining of tacit ... interco-operation, social transformation, universal character, education The mission and corporate values summarize the corporation and the culture of all the firms belonging to it: customer satisfaction, ... will add value and establish learning as a continuous process within the organization The process of implementation of a KM strategy involves the operations of creation, storage, distribution and...

Ngày tải lên: 24/01/2014, 00:20

... ịt ỵ A2 expkHX;2 ịt ỵ A3 where A1 , A2 , and A3 are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2 are the apparent exchange rate constants for the fast and slow amide ... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... that other phenomena, such as electrostatic stabilization of the transition state, formation of covalent intermediates, steric strain, near attack conformations, substrate desolvation, low barrier...

Ngày tải lên: 19/02/2014, 05:20

... Poaceae Calamus walkeri Acacia auriculiformis Musaceae Wendlandia glabrata Licuala spinosa Tarrietia javanica Cleistanthus aff myrianthus Melocalamus compactiflorus Afzelia xylocarpa Tools The future ... occurs An old cemetery is situated in the middle of an Acacia plantation, and the remains of abandoned villages can be found around the small tree forest in the village area These land features ... Animal Pahy Latin/English LUVI Pahy/English LUVI Pheo Ki re Tràm Pe A xop A ro Huen Pa lar Tu vien Poaceae/bamboo Calamus walkeri /rattan Acacia auriculiformis/Acacia Musaceae/banana Wendlandia...

Ngày tải lên: 21/02/2014, 04:20

... consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... aim of the national report is to review existing information on the use of, and threats to, the Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman...

Ngày tải lên: 06/03/2014, 15:21

... (e) The AMY1 concentration [E]0 was 38.8 lM decreasing to 37.3 lM by addition of acarbose A0 is the AMY1 absorbance without acarbose, A is the absorbance measured at the above acarbose concentrations ... dissociation constants In this equation, it was easier for a calculated constant to compare its value relative to zero rather than to obtain a large value When the association constant value was close ... Statistical analysis of the experimental initial rates (v) was performed using the general MichaelisMenten initial velocity equation for determination of kcat and Km and calculation of the catalytic...

Ngày tải lên: 08/03/2014, 08:20

... suppressed as compared with that in the ParA1 zone In the ParA1 zone, the ion leakage increased dramatically within 12–24 h, whereas in the PR zone the ion leakage rose to a peak of  25% at 12 h and then ... level after ParA1 treatment H2O, H2O pretreatment; H + ParA1, ParA1 infiltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ABA treatment All the spectra ... representative of at least three measurements under the indicated conditions (C) The relative content of OH• in the H + ParA1, A4 00 and A + ParA1 zones against the H2O zone Mean values ± standard...

Ngày tải lên: 15/03/2014, 00:20

... variant to the Kd value of the wild-type 4-kDa peptide Of the 19 alanine Table Association rate constants (ka), dissociation rate constants (kd) and dissociation constants (KD) for binding alanine ... Summary of alanine scanning of the 4-kDa peptide The results are expressed as the ratio of dissociation of the variant to that of the wild-type The amino acids mutated to alanine are designated ... coupling The 43-kDa protein solution was passed through the flow cells as an analyte Interaction of ligand and analyte was detected in real time as a change in the SPR signal The association and dissociation...

Ngày tải lên: 17/03/2014, 03:20

... of increasing catalase concentrations (0, 2.4, 4.8 and 7.2 lM, respectively) The effect of ventilating the reaction at the highest catalase concentration was also investigated as shown strongly ... peroxide that has escaped from the enzyme and become aquated, whilst methane oxidation may be catalysed by nonaquated hydrogen peroxide at the active site A further complication arises when one considers ... electron transfer was detected, the constant kf being the same as that observed with MMOH alone (data not shown) When an excess of catalase was added to the MMOH/ MMOB complex the current remained...

Ngày tải lên: 17/03/2014, 09:20

... temperature The mass of air was calculated from the known volume (i.e., the volume of the chamber) and the density of air at room temperature The concentration of the methanol was calculated from the ... ratio between the mass of methanol and that of air inside the test chamber The same applied to acetone The concentrations of methanol vapor ranged from 1.3 to 6.4 ppt This range of methanol concentrations ... film Compared to a large film of flat surfaces, these small islands of the same thickness as the film have a higher surface- to-volume ratio Therefore, their SI (and consequently the SI of the inkjet-printed...

Ngày tải lên: 19/03/2014, 16:48

... 5¢-(CCCTCTAGACCAGATCCTTCACGTATTAAGTC TACACG)-3¢; CD38-G68E, primer 3: 5¢-(GATGAGGC AGCGCTCGagGAAGATGTC)-3¢; CD38-G68E, primer 4: 5¢-(GGGGAATTCATGGCTAACTATGAATTTAGC CAG)-3¢ The E150L PCR product was ... CA, USA) Surface biotinylation of proteins To analyze the stability of CD38 on the plasma membrane of the different Ba/F3 mutants, labeling of the surface proteins with the membrane impermeable ... 3B), these data suggest that these domains are not obligate for the stabilization of the dimers, but rather must contribute to the overall stability of the dimers Crystallographic analysis of the...

Ngày tải lên: 23/03/2014, 12:20

... interpretation of data, drafting the manuscript and acquisition of funding AO contributes to the analysis and interpretation of data, drafting the manuscript and acquisition of funding All authors have ... conception and design, the conduction of the experiment, the collection, analysis and interpretation of data, the drafting the manuscript and acquisition of funding RWC contributes to the analysis and ... phosphatidylcholine backbones It was found that the total percentage of all saturated fatty acids was about 39% and the majority of fatty acids were unsaturated fatty acids (61%) As two fatty acids...

Ngày tải lên: 20/06/2014, 00:20

... the other required assumptions Similar considerations can be done for the p-Laplacian operator too, using Theorem 2.5 Author details Dipartimento di Matematica - Università di Bologna, Piazza ... the proof proceeds as that of Theorem 3.1, applying Theorem 2.4 instead of Theorem 2.3 □ Finally, in the case of p-Laplacian operators, the following result holds, as a consequence of Theorem ... hence the present condition (2.8) implies the validity of the analogous condition with g > 1, assumed in [11] (see condition (8)) But, on the other hand, taking g > one can lose the summability of...

Ngày tải lên: 20/06/2014, 22:20

... polynomial is out of the scope of this research work) Page of 10 the urban area was utilized for this purpose The time delay and the corresponding average powers in the case of a 12 tap configuration ... provide the optimal resource allotment by following a fairness fashion, which means that all users were always served under a one-to-one optimal allocation scheme From the analysis of the obtained ... greater or equal than the number of zeros in a column, an horizontal line is traced The row/column traced is crossed or discarded, and the one-by-one comparison is made once again between the...

Ngày tải lên: 21/06/2014, 00:20

... Experimental Characterization In this section we present an experimental study of the use of the LQI as an estimator of the LDR, to identify the potential advantageous and adverse characteristics of the ... distinguish the qualities of the good links of a path, and the fact that it may not take into consideration the hop count of a path 4.8 MAX-LQI and RQI In the MAX-LQI metric [21], the path with the best ... including the LQI of lost packets [19] 6.2 Variability of the LQI of a Link Figure depicts the standard deviation of the LQI against the average values of LDR (%) EURASIP Journal on Wireless Communications...

Ngày tải lên: 21/06/2014, 11:20

... H-M: On the stability of an n-dimensional quadratic and additive functional equation Math Inequal Appl 9, 153–165 (2006) [12] Kannappan, Pl, Sahoo, PK: On generalizations of the Pompeiu functional ... i=1 as the equation for the spaces of generalized functions Using the fundamental solution of the heat equation, we solve the general solution and prove the Hyers– Ulam stability of this equation ... Isac, G, Rassias, ThM: Stability of Functional Equations in Several Variables Birkh¨user, Boston (1998) a [6] Jung, S-M: Hyers–Ulam–Rassias Stability of Functional Equations in Nonlinear Analysis...

Ngày tải lên: 21/06/2014, 20:20