Ngày tải lên: 04/06/2014, 12:23
... central mechanism that can be specifically targeted for the treatment of cancer Caspases are a family of proteins that play an important role as effectors of apoptosis The caspases are a group of ... to thank all the staff at Dept of Physiology especially Dr.Prakash Hande and Dr Lina Lim for their guidance I am grateful to Ms Asha Rekha Das, Vasantha and Kamsitah for their administrative ... One caspase can activate another caspase leading to the formation of a caspase cascade that amplifies the death signal In a typical cell undergoing apoptosis two distinct mechanisms have been...
Ngày tải lên: 16/09/2015, 17:11
Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 2
... mitochondrial translocation of Bax In addition, the relative lack of caspase activation and absence of downstream Bid cleavage provide additional evidence in favor of a mechanism for signaling Bax to ... mitochondria that is either parallel to or independent of death receptor and/or caspase activation A similar mechanism of caspase-independent conformational change of Bax on triggering apoptosis has ... Ceramide induces mitochondrial activation and apoptosis via a Bax-dependent pathway in human carcinoma cells Oncogene 2002;21:4009 –19 45 Sawada M, Nakashima S, Banno Y et al Ordering of ceramide...
Ngày tải lên: 16/09/2015, 17:11
Tumor cell response to drug induced apoptosis is a function of intra cellular redox status 1
... function of activation of the apoptotic death pathway as evidenced by the significant increase in caspase activity, cleavage of the caspase-3 substrate PARP, and appearance of the sub-G1 fraction ... fluorimetric assays, and (C) poly(ADP ribose) polymerase cleavage was assessed by Western blot analysis D, DNA fragmentation was determined by propidium iodide staining and the appearance of sub-G1 fraction ... increases in caspase-3 and -9 activity, preincubation with RSV significantly inhibited both caspases and the cleavage of the caspase-3 substrate PARP (Fig 4B) That this inhibition was mediated via...
Ngày tải lên: 16/09/2015, 17:11
Báo cáo y học: "Allometric scaling of the maximum metabolic rate of mammals: oxygen transport from the lungs to the heart is a limiting step" pdf
... 1.193, and the SSR is 1.6269 In the analysis of data in Table 1, it is assumed that maximum oxygen uptake is proportional to cardiac output (i.e Uo is constant) A more reasonable assumption is that ... Rahal CJ: Measurement of Plasma Colloid Osmotic Pressure in Normal Thoroughbred Neonatal Foals Davis California: University of California; 2003 Agur AM, Ming JL, Grant JC: Grant's Atlas of Anatomy ... which is close to the value from LSLR of data simulated using Equation (6) A similar approximation analysis of Equation (5) shows that it too is approximately a power function when α is approximately...
Ngày tải lên: 13/08/2014, 23:20
The small GTPASE ARF like protein 1 (ARL1) is a new regulator of golgi structure and function
... ClassII: ARF4, ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ARF6 Fig Classification of mammalian ARF famlily small GTPases Ran Sar Sar 1a, Sar1b Fig A schematic ... members at the moment 12 13 human ARF1 human ARF mouse ARF2 mouse ARF2 human ARF3 human ARF3 human ARF4 human ARF4 human ARF5 human ARF5 human ARF6 human ARF6 rat Arl1 rat Arl1 human Arl5 human Arl5 ... Arl3p, are homologues of mammalian Arl1, Arl2 and ARFRP1 respectively (Takai et al., 2001) 10 Table A comparison of the identities and divergences of the mammalian ARF and Arl subfamily of small...
Ngày tải lên: 17/09/2015, 17:20
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... Minneapolis, USA) This assay measures biologically active VEGF121 and VEGF165 Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis test ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and ... optimal cut-off values Data are displayed as median and range (minimum to maximum) unless otherwise stated All statistical analyses were performed with the SPSS Page of (page number not for citation...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"
... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... diagnosis of sepsis on admission to the ICU Eosinopenia may become a helpful clinical tool in ICU practices interpretation of data, and gave the final approval of the manuscript All authors read ... of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ...
Ngày tải lên: 25/10/2012, 10:35
Optimum feeding rate of solid hazardous waste in a cement kiln burner
... types of chemical and hazardous wastes vary greatly, it is difficult to specify a typical analysis and generalize about the impacts of burning of chemical and hazardous waste Some researchers have ... determination of proximate analysis, heating value, bulk density and particle size distribution The proximate analysis was carried out using a Las Navas Automatic Multiple Sample Thermogravimetric Analyzer ... freely distributed volume The particle size was analyzed by mechanical sieving using a Retsch AS200 instrument Additional chemical analyses of the fuels were available from the plant laboratory ISSN...
Ngày tải lên: 05/09/2013, 15:28
Tài liệu .An ARCO Book ARCO is a registered trademark of Thomson Learning, Inc., and is used herein under pptx
... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... these arguments differ from that of the stem paragraph (A) is a valid argument: Given anything that is a war, if any war is to be condemned, then all wars are to be condemned (B) is not a valid argument ... as wide of a margin as any candidate in the state’s history (A) she was reelected with as wide of a margin as any candidate in the state’s history (B) she had been reelected with as wide of a...
Ngày tải lên: 20/01/2014, 20:20
Tài liệu Chiếu sáng trong truyền hình - Television Lighting Television is a means of changing pptx
... within a scene have the same color temperature A combination of filters and electronic adjustments is used to adapt color cameras to each new lighting situation Most cameras can adjust automatically ... or black level, of zero IRE, rather than the 7.5 IRE broadcast standard Some cameras that automatically boost the signal in low light situations can also be run in manual mode where you can control ... practice, actual contrast ranges are rarely measured using a meter A subjective analysis based on camera output is generally sufficient Color Temperature The third consideration is color temperature...
Ngày tải lên: 26/01/2014, 04:20
Learning english is a piece of cake 1
... English is difficult and it’s hard to memorize new words ðeɪ θɪŋk ˈɪŋ ɡlɪʃ ɪz ˈdɪfɪk əlt ænd ɪts hɑːrd tə ˈmem ə raɪz njuː wɜːdz and grammatical rules In fact, learning English can be a piece of ... ˈeɪʃ ən doʊnt ˈ wɝːɪ ə ˈbaʊt ˈɡræm ə Don’t be afraid of making mistakes Just try to speak doʊnt biː ə ˈfreɪd ʌv ˈmeɪk ɪŋ mɪ ˈsteɪk dʒʌst traɪ tuː spiːk Speak English as much as possible spiːk ˈɪŋ ... In fact, she is a sales person! “Improve” = cải thiện, cải tiến I want to improve my English! Many people are worried about learning English ˈmen i ˈpiːpl ɑːr ˈwʌrid ə ˈbaʊt ˈlɝːn ɪŋ...
Ngày tải lên: 27/01/2014, 20:11
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... (Duchefa, Haarlem, The Netherlands) Tissues were cleared in ethanol and visualized with a stereomicroscope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated ... buffer and [c-32P]-ATP MBP was used as an artificial substrate to assess the kinase activity and GST alone was used as a negative control The top panel shows the kinase assay visualized by autoradiography...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... structure of Met8P has shown that this protein has an aspartate residue (Asp141), which is important for both chelatase and dehydrogenase function [17]; interestingly, this aspartate, Asp129, is also ... lacking iron and ⁄ or with the side chain saturated, but accessing these putative substrates is not trivial An alternative approach would be to seek accumulation of the substrate of NirF in a ... biosynthetic pathway, for example, oxidation of C17 propionate to give an acrylate side chain This type of step would normally require FAD-based chemistry Another potential dehydrogenation is NAD ⁄ NADP-dependent...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ... GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC ... GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
... variant Activity (%) t½ (min) Wild-type T9 6A F10 0A V12 6A F12 8A S12 9A E13 0A V13 1A E13 2A R13 3A R13 5A F13 6A I13 7A I13 8A N13 9A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N15 2A E28 3A E28 5A K32 5A ... SDS/PAGE analysis After 24 h, the fraction of molecules behaving as a substrate for uPA decreased approximately twofold for PAI-1(V12 6A) , PAI-1(F10 0A) , PAI-1(F12 8A) and PAI-1(W14 1A) with a concomitant ... indistinguishable results: wild-type, PAI-1(T9 6A) , PAI1(F10 0A) , PAI-1(V12 6A) , PAI-1(F12 8A) , PAI-1(I13 7A) , PAI-1(I13 8A) , PAI-1(N13 9A) , PAI-1(W14 1A) , PAI1(T14 6A) and PAI-1(M149K) Structural analysis Structural...
Ngày tải lên: 20/02/2014, 11:20
Tài liệu What is a high school worth?: A model of Australian private secondary school fees docx
... program An alternative to either of these is the International Baccalaureate (IB) and a small number of schools, mainly private, offer the IB diploma Table reports some standard VCE statistics across ... (bas) It is a group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon College; Ballarat and Queens Anglican Grammar School; Ballarat ... English Attendance ICSEA Number of Teachers Number of Support Staff Read7 Write7 Spell7 Grammar7 Math7 School Associations: ASPV AGSV GV ACC ACOED BAS CAS Sandhurst EID GIS SIS Region: Cental East...
Ngày tải lên: 20/02/2014, 19:20