... dependence of Vβ [φ0 , T ] at several values of T around Tc IV CONCLUSION AND OUTLOOK Due to growing interest of phase transition we considered a non-relativistic model of idealized Bose gas We have ... ’s at low and high temperatures were considered in detail, giving rise to the well-known formula of Lee and Yang and other results for single Bose gas It was indicated that the symmetry restoration ... takes place at Tc 300 nK and phase transition is second order REFERENCES [1] G Amelino-Camelia, arXiv:hep-th/9603135 70 TRAN HUU PHAT, LE VIET HOA, NGUYEN CHINH CUONG [2] J M Cornwall, R Jackiw,...
Ngày tải lên: 30/10/2015, 20:54
... regarding a likely partial gastrectomy but also informed that a total gastrectomy and even a multi-visceral resection may be needed At operation, he was found to have a softball-sized mass attached ... resistance to Imatinib in advanced gastrointestinal stromal tumors are predicted by different prognostic factors: A European Organisation for Research and Treatments of Cancer-Italian Sarcoma Group-Australasian ... mutations and chromosome rearrangements and their clinical correlation in gastrointestinal stromal (pacemaker cell) tumors Am J Pathol 2002, 160:15-22 Savage DG, Antman KH: Imatinib mesylate – a...
Ngày tải lên: 09/08/2014, 04:21
Pressure drop prediction of a gasifier bed with cylindrical biomass pellets
... prediction Particle size of a reacting bed can be calculated by applying mass balance for one particle and mass of char particle mchar and mass of initial biomass particle mbiomass can be related as, ... ratio for calculating Equivalence Ratio (ER) Gas flow rate was calculated by applying Nitrogen balance over the gasifier The average gas properties such as density and viscosity within the gasifier ... The average mass conversion within the bed can be calculated based on the C, H and O molar balance Table summarizes the molar inputs, outputs and also accumulated in char From molar rates of each...
Ngày tải lên: 01/08/2016, 09:30
Báo cáo nghiên cứu khoa học: "NUMERICAL MODEL OF SINGLE PHASE TURBULENT FLOWS FOR CALCULATION OF PRESSURE DROP ALONG GAS PIPELINES " doc
... data-sample in table 3.1 along the associated gas pipeline of flow equations of Weymouth, Panhandle A, Panhandle B and Clinedinst are stored in table 3. 2a and 3.2b Table 3. 2a Pressure along associated ... input data - sample in table 3.1 along the associated gas pipeline of flow equations of Weymouth, Panhandle A, Panhandle B and Clinedinst are stored in table 3. 3a and 3.3b Table 3. 3a Pressure along ... 7040 kPa The results with input data - sample in table 3.1 along the associated gas pipeline of flow equations of Weymouth, Panhandle A, Panhandle B and Clinedinst are stored in table 3. 4a and 3.4b...
Ngày tải lên: 22/07/2014, 10:21
AN1299 single shunt three phase current reconstruction algorithm for sensorless FOC of a PMSM
... TABLE IH 2H 3H 1L 2L 3L IBUS ON OFF OFF OFF ON ON +IA OFF ON OFF ON OFF ON +IB OFF OFF ON ON ON OFF +IC OFF ON ON ON OFF OFF –IA ON OFF ON OFF ON OFF –IB ON ON OFF OFF OFF ON –IC FIGURE 15: SAMPLING ... eliminates the need to calibrate each phase amplification circuit or compensate in software Disadvantages During single- shunt measurements, a modification on the sinusoidal-modulation pattern ... Technology Inc AN1299 ADVANTAGES AND DISADVANTAGES OF USING A SINGLE- SHUNT RESISTOR Advantages As previously mentioned, one of most important reasons for single- shunt three -phase reconstruction...
Ngày tải lên: 11/01/2016, 17:06
Implementation of a single phase electronic watt hour
... consists of an integer part and a fractional part, the integer part is realized by providing an N samples delay The fractional part is realized by a fractional delay filter (refer to: Phase compensation) ... cause harm and take appropriate remedial actions Buyer will fully indemnify TI and its representatives against any damages arising out of the use of any TI components in safety-critical applications ... that provide a larger phase shift than this maximum, an entire sample delay along with fractional delay must be provided This phase compensation can also be modified on the fly to accommodate...
Ngày tải lên: 21/09/2016, 23:47
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs
... [1] Saini J.S Use of artificial roughness for Enhancing Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; ... Turbulators Transactions of the ASME Journal of turbo machinery199 1a; 113: 360-366 [7] Lau S.C., McMillin RD and Han J.C Heat transfer characteristics of Turbulent flow in a square channel with angled ... these parameters were kept constant and only the relative gap width was varied to see the effect of this parameter on enhancement of heat transfer For the flow visualization inside a rectangular...
Ngày tải lên: 05/09/2013, 16:10
Design and Implementation of a Three-Phase Induction Motor Control Scheme
... Therefore, data acquisition, debugging and fault logging are realized • × fast A/ D (Analogue to Digital) converters with 10-bit resolution make the computation of accurate, real-time phase current measurements ... between phase A and phase B (VAB = VA – VB) This is because it is connected in a three -phase Y format, this can be seen in Figure 5.5 As a consequence of this, a sinusoidal signal is created (see ... MATLAB program can convert a MATLAB design into a C-code design in a relatively straightforward manner Hence, this stage of the thesis project is seen to be of great importance 6.1 MATLAB – An...
Ngày tải lên: 27/10/2013, 23:15
Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc
... 1, January 1991, pp 62-72 [2] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Dead Beat Control of threePhase PWM Inverter", IEEE Transactions on Power Electronics, Vol 5, No 1, January ... that it does not affect the output voltage References [1] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Digital Control of three -Phase Inverter with LC Filter", IEEE Transactions on Power ... way the battery will be alway charged a the Maxim t w ys at mum Power P Point The go of the sy oal ystem illustra ated in figure is to supply th as well as single ph i s hree hase loads of any...
Ngày tải lên: 19/01/2014, 02:20
Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt
... information obtained from the OSCE participating States Albania, Armenia, Austria, Azerbaijan, Belarus, Bosnia and Herzegovina, Bulgaria, Canada, Croatia, Cyprus, Czech Republic, Denmark, Estonia, ... examination and assessment of the efficiency, the advantages and disadvantages of various international and national content regulation measures – particularly vis-à-vis fundamental rights of ... Italy responded positively to this question 44 (78.6%) states responded negatively and Albania, Azerbaijan, Belarus, Kazakhstan, Kyrgyzstan, Latvia, Lithuania, Norway, and Poland explicitly stated...
Ngày tải lên: 18/02/2014, 00:20
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... were ¨ carried out in an Aktapurifier-100 apparatus (Amersham Pharmacia Biotech UK Limited) The native PsbQ protein was first passed through a cation-exchange High-Trap SP column (1 mL) (Amersham Biosciences ... than average and their maximum values are around The values for all these parameters obtained for the PsbQ model were quite good and the programs did not mark any as poor or inappropriate Another...
Ngày tải lên: 21/02/2014, 00:20
Báo cáo khoa học: Epoxidation of benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 in reconstituted membranes Effects of charge and nonbilayer phase propensity of the membrane pot
... experiments Statistical significance of results between lipid systems was analysed using oneway ANOVA software (GraphPad software, San Diego, CA, USA) Ó FEBS 2002 Membrane-reconstituted human CYP 1A1 (Eur ... ratio of 1200 The intra- and interday degree of variation in relative P450, reductase, and lipid content did not exceed 10% in any of the vesicular preparations Finally, standardized amounts of ... to investigate the impact of the hexagonal phase forming tendency by Yang and Hwang [31] Data in Fig 1A and in Table show that the activity of CYP 1A1 is significantly enhanced (P < 0.001, considered...
Ngày tải lên: 08/03/2014, 10:20
sensitivity properties of a novel no2 gas sensor based on mesoporous wo3 thin film
... oxidizing and reducing gases The stability of the sensing characteristics was examined several times in a week It was found that the initial resistance was approximately maintained, but with a slightly ... sensitivity of metal-oxide gas sensors, Sens Actuat B 24 (1995) 454–457 [23] H Arai, H Tominaga, An infrared study of nitric oxide adsorbed on rhodium–alumina catalyst, J Catal 43 (1976) 131–142 225 at ... 225 at National Cheng Kung University, Tainan, Taiwan His major research has related to mesoporous materials, and battery materials Jiann Shieh received his BS, MS and PhD degrees of Materials Science...
Ngày tải lên: 20/03/2014, 13:07
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf
... Collinge AJ (1974) Occlusion of the septal pores of damaged hyphae of Neurospora crassa by hexagonal crystals Protoplasma 80, 57–67 19 Yuan P, Jedd G, Kumaran D, Swaminathan S, Shio H, Hewitt D, Chua ... bodies of N crassa are smaller with an average size of 2934 To corroborate the appearance of hexagonal HEX1 structures in BY4742, this strain was also analyzed by electron microscopy The untransformed ... secondary antibodies applied were obtained from Molecular Probes (Alexa Fluor 594 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG) Acknowledgements We thank F Nargang for the N crassa...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
Ngày tải lên: 23/03/2014, 13:20
Combustion and emission characteristics of a natural gas fueled diesel engine with EGR
... natural gas diesel engine Energy 2010;35:1129–38 [11] Wannatong K, Akarapanyavit N, Siengsanorh S, Chanchaona S Combustion and knock characteristics of natural gas diesel dual fuel engine SAE paper ... mode This is because of the very lean mixture of gaseous-fuel and air at part load, and the associated poor fuel utilization efficiency In such a case, large portion of natural gas escapes from the ... Pirouzpanah V, Khoshbakhti Saray R, Sohrabi A, Niaei A Comparison of thermal and radical effects of EGR gases on combustion process in dual fuel engines at part loads Energy Convers Manage 2007;48:1909–18...
Ngày tải lên: 15/06/2014, 09:26
báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc
... PBMC was evaluated Calibration standard curve and linearity of dilution Due to the lack of a standard reference material, calibration standard curves were not evaluated for quantification of cellular ... one patient, as an example, was detected by all three validated clinical assays, HLA -A2 MART-1 tetramer assay, IFNγ real time RT-PCR and ELISPOT (Figure and Table 10), demonstrating the assay utility ... defined as the lowest concentration of an analyte that the bioanalytical procedure can reliably differentiate from background noise LOQ is defined as the lowest amount of an analyte in a sample that...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học:" Validation of a flow cytometry based chemokine internalization assay for use in evaluating the pharmacodynamic response to a receptor antagonist" potx
... the guidance for ligand binding assays [12] as a foundation in which to base the validation of a flow cytometry pharmacodynamic assay and applying the "appropriate" parameters for a cell based cytometry ... (Table 5) In-study results This assay was used as a pharmacodynamic marker for biological activity of a CCR2 antagonist in a clinical trial consisting of 108 healthy individuals The data generated ... individuals) Accuracy, as classically defined for ELISA and mass spectrometry based technologies, is the ability of an assay to measure analyte against a standard or quantitative control (QC) and is the...
Ngày tải lên: 18/06/2014, 15:20
báo cáo sinh học:" Narrowing the gap between eye care needs and service provision: a model to dynamically regulate the flow of personnel through a multiple entry and exit training programme" pdf
... A3 A3 A3 A3 A2 A2 A2 A2 A1 Eye Car e Tr aining Modules H2 A1 A1 A1 Eye car e nur se Catar act sur geon Optometr ist Ophthalmologist Figure Example 1of the use of a proposed modular training system ... synthesis of a large number of small units of activity and how each relates to Leave Training St a g e Training Ex i s t i n g W/F Upgraded St a g e Training St a g e Training St a g e Training ... will be: available free of charge to the entire biomedical community At a later date, the financial data associated with the personnel flows will be addressed by adding the costs associated with...
Ngày tải lên: 18/06/2014, 17:20