... extraction technique described in the previous section. A. RBF neural network description The radial basis function neural network (RBFN) theoretically provides such a sufficiently- large network ... sufficiently- large network structure that any continuous function can be approximated within an arbitrary degree of accuracy by appropriately choosing radial basis function centers [12]. The RBFN is ... Engineering and Technology 42, 2008. [17] Daw-Tung Lin,”Facial Expression Classification Using PCA and Hierarchical Radial Basis Function Network, ” Journal of Information Science and Engineering...
Ngày tải lên: 28/04/2014, 10:17
MẠNG RADIAL BASIS
... lớp radial basis và một lớp tuyến tính đ c biệt. C u tr c mạng Mạng này c c u tr c tương tự mạng radial basis, nhưng hơi kh c ở lớp thứ hai. CHƯƠNG 6 MẠNG RADIAL BASIS Mạng Radial Basis c ... kh c. C u tr c mạng Giả sử rằng c Q c p vector vào/vector đích. Mỗi vector đích c K thành phần. Một trong c c thành phần là 1, c n lại là 0. Do đó, mỗi vector vào chỉ ứng với một trong c c lớp K. ... vector x c suất. Cuối c ng, hàm truyền c nh tranh ở ngõ ra c a lớp thứ hai lấy thành phần c x c suất lớn nhất, và cho giá trị ngõ ra là 1 đối với lớp đó và 0 đối với tất c c c lớp kh c. C u...
Ngày tải lên: 29/09/2013, 06:20
Báo cáo đồ án trí tuệ nhân tạo: xây dựng chương trình sử dụng Radial basis functions networks để tìm đường phân lớp 2 tập điểm trên không gian
... test này đến c c tâm c a mạng, c c giá trị này sẽ đư c lưu vào 1 ma trận khoangcach c n hàng 1 c t Ma trận W sau khi chuyển vị c 1 hàng n c t nhân với ma trận khoảng c ch n hàng 1 c t sẽ tạo ... những c ch khá phổ biến là sử dụng mạng c c hàm c sở dạng bán kính (Radial Basis Functions network – RBF) do mạng hàm c sở bán kính c khá nhiều ưu điểm so với c c phương pháp kh c: 1. Hàm ... quả c a ma trận trọng số mới tạo ra Class Matran: Lưu c c phương th c của ma trận như nghịch đảo, nhân Class Toado: C c thu c tính về tọa độ c a 1 điểm bào gồm TdoX và TdoY Sau khi khởi động chương...
Ngày tải lên: 25/03/2014, 22:19
Báo cáo đồ án trí tuệ nhân tạo : xây dựng chương trình sử dụng Radial basis functions neural networds để tìm đường phân lớp 2 tập điểm
... tìm c c tham số c a mạng bao gồm: trọng số , tâm c a c c hàm bán kính , tham số c a c c hàm bán kính . Hàm sai số (error function) : Để x c định c c tham số c a mạng, ta phải đưa ra một tiêu chí ... đạo hàm c a theo c c biến rồi chỉnh lại c c tham số này. Một c ch tối ưu hóa kh c là: 1. C định , tính theo phương pháp trên. 2. C định , chỉnh sửa theo phương pháp đạo hàm. 3. Lặp bư c 1,2. Trong ... 1,2. Trong th c hành, người ta thấy vi c tìm rất mất thời gian. Do đó, c c tâm thường đư c chọn là chính c c mẫu h c. C n đặt giá trị sau đó chọn thử một vài giá trị đến khi đạt đư c kết quả như...
Ngày tải lên: 25/03/2014, 22:41
báo cáo hóa học: " A radial basis classifier for the automatic detection of aspiration in children with dysphagia" doc
Ngày tải lên: 19/06/2014, 10:20
Báo cáo hóa học: " Field Emission and Radial Distribution Function Studies of Fractal-like Amorphous Carbon Nanotips" potx
Ngày tải lên: 22/06/2014, 01:20
adaptive basis function construction an approach for adaptive building of sparse polynomial regression models
Ngày tải lên: 27/07/2014, 23:16
Báo cáo khoa học: The structural basis for catalytic function of GMD and RMD, two closely related enzymes from the GDP-D-rhamnose biosynthesis pathway pdf
... aeruginosa,5Â-AGGCCCGCTTC C GGATCCACTCAGCGTCTG-3Â and 5Â-AAAAAAGTCG ACTTCTTCTCGTACCCGTGACTC-3Â; and A. thermo- aerophilus,5Â-TT GGATCCATGAGAGCCCTAATCACTG GA-3Â and 5Â-TA GGTACCTTATGCTTGACGGTAACT TTGT-3Â. ... bacterium produces a cell surface polymer known as A-band O polysaccharide, which consists of a linear d-Rha homopolymer attached to lipopolysaccharide [19]. The function of A-band lipopolysaccharide ... (1989) Occur- rence of a common lipopolysaccharide antigen in stan- dard and clinical strains of Pseudomonas aeruginosa. J Clin Microbiol 27, 962–967. 21 Rocchetta HL, Burrows LL, Pacan JC &...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo Y học: The expression of glutathione reductase in the male reproductive system of rats supports the enzymatic basis of glutathione function in spermatogenesis doc
... the recycling method described by Anderson [27]. Briefly, cultured cells were collec ted and washed t wice with NaCl/ P i . The precipitated cells were sonicated in 5% 5-sulfosul- icylic acid. ... cultured spermatogenic and Sertoli cells To identify cells that express GR more clearly, testicular cells were separated under the culture con ditions. As Sertoli cells bec ome attached to conventional plastic ... GR cDNA probe [25] at 42 C in the presence of 50% formamide, the membranes were washed twice for 20 min at 55 °Cin2· NaCl/Cit (1 · NaCl/Cit: 150 m M NaCl and 15 m M sodium citrate, pH 7.5) containing...
Ngày tải lên: 17/03/2014, 17:20
Chapter 2Communicating Over the Network Quangkien@gmail.com.OverviewDescribe the structure of a network, including the devices and media that are necessary for successful communications. Explain the function of protocols in network communications. Ex potx
... Area Networks (WANs) Leased connections through a telecommunications service provider network. Networks that connect LANs in geographically separated locations Telecommunications service provider ... intermediary network devices are: – Network Access Devices (Hubs, switches, and wireless access points). – Internetworking Devices (routers). – Communication Servers and Modems. – Security Devices (firewalls) ... network communications. Protocols 30 Networking protocols suites include rules for: (4) Format Accessing the media Error detection Setup and termination Chapter 2 Communicating Over the Network Quangkien@gmail.com ...
Ngày tải lên: 01/04/2014, 12:20
Monitoring function in optical network
... C- , L- or C CL-band nm Channel number (for C- band) >80 >40 Absolute wavelength accuracy ˙50 pm Relative wavelength accuracy ˙30 pm Dynamic range >30 (typically 50) dB Maximum input channel ... successfully implemented in dual port optical spectrum analysers, which became recently commercially available (EXFO; JDSU). Another method is the optical subcarrier monitoring in which each ... provide a much more accurate prediction of the impairments, especially for CD and PMD. This approach can be extended to more complex modulation schemes: asyn- chronously generated constellation...
Ngày tải lên: 30/05/2014, 21:46
Báo cáo hóa học: " Editorial Network Structure and Biological Function: Reconstruction, Modeling, and Statistical Approaches" pdf
Ngày tải lên: 22/06/2014, 00:20
Báo cáo y học: "Broad network-based predictability of Saccharomyces cerevisiae gene loss-of-function phenotypes" pdf
Ngày tải lên: 14/08/2014, 08:20
Báo cáo y học: "Influence of metabolic network structure and function on enzyme evolution" pptx
Ngày tải lên: 14/08/2014, 16:21
phylogenetic approaches to protein function prediction and protein network analysis
Ngày tải lên: 13/11/2014, 15:55
Tổng quan về NAT (Network Address Translation)
... xử kh c với HTTP packet. Cho một ví dụ chỉ sử dụng một virtual server ho c DNS cho tất c c c service nó đư c map tới c c host cung c p service th c sự , nhiều service thậm chí đư c cung c p ... vì máy chủ sẽ luôn dùng c ng một địa chỉ IP th c . C ch th c th c hiện NAT tĩnh thì dễ dàng vì toàn bộ c chế dịch địa chỉ đư c th c hiện bởi một c ng th c đơn giản: Địa chỉ đích =Địa chỉ mạng ... th c đề c p ở trên c ng c thể đư c áp dụng vào th c tiễn cho vi c x c định c n bằng tải ngoài ra c thể c một c ch tính toán nào đó tốt nhất mà chúng ta chưa tìm ra. C nhiều c ch tiếp c n để...
Ngày tải lên: 15/08/2012, 10:40