r1a p8a and icr a cell lines

... macrophages and B cells [22-24] Normal prostate (i.e from asymptomatic prostate disease-free men) contains scattered stromal and intraepithelial T and B lymphocytes, macrophages and mast cells [23], ... proviral load by a TaqMan real-time PCR assay J Clin Microbiol 2001, 39:1303-1310 Da Silva M, Shevchuk MM, Cronin WJ, Armenakas NA, Tannenbaum M, Fracchia JA, Ioachim HL: Detection of HIV related ... vivo Localization Localization and characterization of HIV-1 RNA positive cells in the human prostate infected ex vivo Localization of HIV RNA+ cells (black silver grains) in prostate explants exposed...

Ngày tải lên: 13/08/2014, 05:21

... 51:1002-1007 Hara I, Miyake H, Yamada Y, Takechi Y, Hara S, Gotoh A, Fujisawa M, Okada H, Arakawa S, Soejima T, Sugimura K, Kamidono S: Neoadjuvant androgen withdrawal prior to external radiotherapy for ... Statistical analysis For descriptive statistics, the software package KaleidaGraph 3.5 (Synergy Software, Reading, USA) was used Means and standard deviations were calculated for each of the data points; ... overall survival after combination therapy were postulated: a) an additive cell killing between androgen ablation and radiotherapy and b) reduced tumor regrowth kinetics after androgen ablation...

Ngày tải lên: 09/08/2014, 10:21

... body fat was substantial, and in most cases larger than the corresponding loss in lean mass According to our data, the average percentage loss of lean mass was 5.7±4.7 and the average change in ... Control-PE reagent to check the non-specific binding of the CD34-PE monoclonal antibody Statistical analysis All data were analyzed by Systat software (Systat Inc) and KaleidaGraph software Variables ... metabolism and inflammation, contributing to the maintenance of energy homeostasis and the pathogenesis of obesity-related metabolic and inflammatory complications [4] Endothelial damage and...

Ngày tải lên: 25/10/2012, 10:51

... conduction via the catalysts and electrode backing at the anode and cathode, and the outer circuit The electrochemical oxidation and reduction reactions at the anode and cathode serve as charge transfers ... important weapons at this early stage, and small companies with technical skills in the field of fuel cell processes have become important partners to the large automotive companies Mathematical ... in the contact area between the electrode and the bipolar plate Contact resistance should be minimized and, if the bipolar plate is made of a metallic material, it is important that low-conducting...

Ngày tải lên: 19/10/2013, 09:15

... CCTAGGGTTGGTTACCAGG Sense: CAGTCACAACAGCCATCTTC Antisense: CCACTGCTTCTCATCATGGT Sense: TTGTTTGGTGCTGGGACAGAG Antisense: GGCTAGGCCCTCTCCTGCACA Sense: AAACTTCATGAAGAAATTGAC Antisense: TCTCCAACACACACACGCTTTCC ... Sense: GTAGCCCACGTCGTAGCAAA Antisense: CCCTTCTCCAGCTGGAAGAC Sense: GAAAGTCAACTCCATCTGCC Antisense: CATAGCACACTAGGTTTGCC Sense: TTGTAACCAACTGGGACGATATGG Antisense: GATCTTGATCTTCATGGTGCTAG 736 331 ... using a digital camera (DC120; Eastman Kodak, New Haven, CT, USA) and densitometric scanning analysis software (1d main; Advanced American Biotechnology, Fullerton, CA, USA) Statistical analysis All...

Ngày tải lên: 14/02/2014, 18:20

... (lane 6), and female gonad (lane 7) Twelve micrograms of total protein extract from each tissue was loaded into the gel A single band of about 79 kDa was detected in female and male gonads Fig ... hybridization and real-time RT-PCR analysis Gonadic development was assayed on histological slides of a transverse section of all the gonadic area according to Fabioux et al [28] for dsRNA-injected and ... contamination RNA concentrations were measured as described above, and RNA quality was checked with a Bioanalyser 2100 (Agilent, Massy, France) From lg of total RNA, RT-PCR amplifications were carried...

Ngày tải lên: 07/03/2014, 00:20

... ras-activated factor/extracellularly regulated kinase (Raf/ERK) pathway and the activation of the p38 MAPK/SAPK2 pathway Independently of these pathways, protein kinase C (PKC) is able to phosphorylate ... revealed increased levels of phosphorylated CREB and ATF-1 (S133), SAPK/JNK (T183/Y185) as well as upregulation at the translational level and activation of ATF-2 (T71) and c-Jun (S73) An increase ... This data indicate that ERK1/2 and SAPK/JNK pathways may be activated apart from each other Both, SAPK/JNK and ERK1/2, are activated upon growth factors binding to their receptors However, signal...

Ngày tải lên: 17/03/2014, 17:20

... Westphalian WilhelmsUniversity, Munster, Germany Ana Krtolica StemLifeLine, San Carlos, California, U.S .A Orly Lacham-Kaplan Victoria, Australia Monash Immunology and Stem Cell Laboratories, Monash ... Chui-Yee Fong, Kalamegam Gauthaman, and Ariff Bongso 14 Amniotic Fluid and Placenta Stem Cells 150 Anthony Atala 15 Adult Stem Cells in the Human Endometrium 160 ´, ´n Caroline E Gargett, Irene ... presence of additional mechanisms regulating maternal mRNA translation in oocytes, other than polyadenylation Therefore, a translational control machinery that is activated in cascades and uses...

Ngày tải lên: 22/03/2014, 20:21

... are shown as means ± standard deviations RNA isolation and quantitative real-time PCR Total RNA was extracted following the TaKaRa RNAiso Reagent manual, and reverse transcribed into cDNA using ... polyclonal antibodies against PTEN (Abcam, Cambridge, MA, USA) or Egr-1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), and mouse monoclonal antibody against b-actin (Sigma) The signals were visualized ... potential application of vitamin D as a novel molecular target in gastric cancer therapies in association with the use of TSA ⁄ NaBu and 5-Aza Results Vitamin D induced apoptosis in gastric cancer cells...

Ngày tải lên: 22/03/2014, 21:20

... 145: 252-260 Vidyarani M, SelvarajP, Jawahar MS, Rajeswari ND, Anbalagan S, Narayanan PR (2007) Intracellular granzyme A expression of peripheral blood lymphocyte subsets in pulmonary tuberculosis ... 503-510 Barcelos W, Sathler-Avelar R, Martins-Filho OA, Carvalho BN, Guimara˜es TMPD, Miranda SS (2008) Andrade HM, Oliveira MHP, Toledo VPCP Natural Killer Cell Subpopulations in Putative Resistant ... Biosciences Pharmigen, San Diego, CA and USA) After Statistical analysis Analyses of the data were performed using Statistical Package for Social Sciences (SPSS) statistical software (Version...

Ngày tải lên: 29/03/2014, 03:20

... global in scope The postglacial warming of Antarcticaếs polar plateau came to a halt for 1,000 years; at the same time, New Zealandếs mountain glaciers made a major advance, and the proportions of ... as the Younger Dryas (after a tundra òower whose habitat expanded signiịcantly), ended about 11,000 years ago Its marks can be found in North Atlantic marine sediments, Scandinavian and Icelandic ... Scientific American, Inc Out of Place A weed is a valuable crop to some farmers T he fate of a fast-growing shrub in Southeast Asia and tropical Africa could pit small farmers against large plantation...

Ngày tải lên: 12/05/2014, 15:02

... 401(6753):616-620 Osada H, Tatematsu Y, Yatabe Y, Nakagawa T, Konishi H, Harano T, Tezel E, Takada M, Takahashi T: Frequent and histological typespecific inactivation of 14-3-3sigma in human lung cancers ... optical density was measured at 720 nm after TCA-addition using a standard Dynatech MR 7000 ELISA photometer (Dynatech, Hamburg) For evaluation, a non-linear standard curve with protein concentrations ... GH, AL, DN, and JP carried out the 2D electrophoresis and all other experimental work PS, ET, and WKH coordinated the laboratory work and helped to draft the manuscript All authors read and approved...

Ngày tải lên: 18/06/2014, 15:20

... Ribas A, Camacho LH, Lopez-Berestein G, Pavlov D, Bulanhagui CA, Millham R, Comin-Anduix B, Reuben JM, Seja E, Parker CA, Sharma A, Glaspy JA, Gomez-Navarro J: Antitumor activity in melanoma and ... for analysis RCK and BC -A contributed to the assay conduct and data interpretation EVE and AR wrote the manuscript All authors read and approved the final manuscript Acknowledgements EvE was supported ... treated with CTLA-4 blockade J Immunol 2005, 175:7746-7754 Comin-Anduix B, Lee Y, Jalil J, Algazi A, de la Rocha P, Camacho LH, Bozon VA, Bulanhagui CA, Seja E, Villanueva A, Straatsma BR, Gualberto...

Ngày tải lên: 18/06/2014, 15:20

... tissues Cell 2007, 131(5):994-1008 50 Basak GW, Yasukawa S, Alfaro A, Halligan S, Srivastava AS, Min WP, Minev B, Carrier E: Human embryonic stem cells hemangioblast express HLA-antigens J Transl ... indicate statistical significance Quantification of peripheral blood cells expressing the hematopoietic stem cell markers CD133 and CD34 was performed at day (pre-treatment) and on days 1, 2, and ... culture, level of cellular ATP was quantified by bio-luminescence The ratio of average values of ATP in growth factor stimulated and not stimulated cells was calculated and compared for different...

Ngày tải lên: 18/06/2014, 16:20

... experiments and the statistical analysis, analyzed and interpreted data and wrote the paper All authors read and approved the final manuscript Competing interests The authors declare that they have no ... int/lowaCD3 mAb and hiaCD3 CIK cells were capable of lysing K562 cells in vitro were affected by cervical carcinoma, but had been heavily pre-treated and had advanced, metastatic disease at study ... 2010 Ayello J, van de Ven C, Cairo E, Hochberg J, Baxi L, Satwani P, Cairo MS: Characterization of natural killer and natural killer-like T cells derived from ex vivo expanded and activated cord...

Ngày tải lên: 18/06/2014, 16:20

... that RNA was amplified and quantified by real-time RT-PCR, viral RNA was contaminated with amplicon DNA prior to UNG incubation and RT-PCR amplification (Fig 1) To accomplish this, a constant amount ... demonstrated that incubation with UNG appears to increase the CT equally for in vitro transcribed RNA and viral RNA, thus quantification through the use of a standard curve can remain accurate provided ... the case of some manufacturers to include UNG as a standard reagent in kits The success of this approach for elimination of contaminating amplicon DNA depends on the availability of a heat-labile...

Ngày tải lên: 19/06/2014, 08:20

... PBS Intraperitoneal injections of PBS or cyclophosphamide were administered on days 1, +1, and +3 after viral inoculation Statistical analysis Analysis of numerical data and statistical analyses ... Priscilla Schaffer and Dr John Balliet (Harvard University Medical School, Boston, MA) The viruses were propagated in Vero cells (American Type Culture Collection, Manassas, VA) and stored as viral ... Hefti HP, Odermatt B, O'Keeffe M, Alber G, Glanzmann B, Riesen M, Ackermann M, Suter M: Flt3 ligandtreated neonatal mice have increased innate immunity against intracellular pathogens and efficiently...

Ngày tải lên: 19/06/2014, 08:20

... grant PI and clinical scoring CA Acquisition of data NKS Statistical analysis AA Interpretation and analysis of data, grant co PI and writing and editing of manuscript All authors read and approved ... probable and possible ALS patients Values are plotted as mean ± SE (Standard error) in the bar diagram Data was analyzed by one-way analysis of variance (ANOVA) followed by Fisher’s least significant ... Gupta PK, Prabhakar S, Sharma S, Anand A: Vascular endothelial growth factor -A (VEGF -A) and chemokine ligand-2 (CCL2) in Amyotrophic Lateral Sclerosis (ALS) patients Journal of Neuroinflammation...

Ngày tải lên: 19/06/2014, 22:20

... IGF-1 Each condition was repeated times The plates were incubated at 37°C Assay was carried out at 1-, 3-.5- and 7-day using above mentioned methods Statistical analyses Standard statistical analytical ... and revised the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Xiaohang Zhao and Lijun Zhou from the central laborary of navy general hospital ... increase at and days compared to the standard medium Effects of growth factors on cell morphology When grown in monolayer culture and standard medium, cells from normal human NP were spindle-shaped...

Ngày tải lên: 20/06/2014, 00:20

... Figure sion assays Detection of NA vRNA, cRNA and mRNA by primer extenDetection of NA vRNA, cRNA and mRNA by primer extension assays Total RNA from infected cells were harvested at and 24 hr postinfection ... segments As the NA and NS vRNA segments in the NSNA and NSNA-U mutants had the identical non-coding sequences, the availability of compatible 5' ends for initiating NS and NA vRNA replications ... that the mutations in the NS vRNA would only affect those vRNA segments with a "U4" promoter, an additional pair of mutants was generated (Supplementary Fig All-U and NSNA-U) The All-U and NSNA-U...

Ngày tải lên: 20/06/2014, 01:20