quantum 1 f effect as a special case
Báo cáo y học: "Herpes simplex 1 encephalitis presenting as a brain haemorrhage with normal cerebrospinal fluid analysis: a case report" pot
... circumscribed brain haemorrhage The patient was transferred to our hospital for further management On admission, the patient was complaining of subjective fever and headache He was febrile with a tympanic ... a CT scan of the patient's brain was obtained after the infusion of iopamidol The enhanced study revealed a 12 mm focus of increased attenuation consistent with a small haemorrhage adjacent to ... Enterovirus as well as for Varicella Zoster Virus A viral culture was not performed Bacterial as well as fungal cultures of the CSF were negative The patient's symptoms worsened with increasing confusion...
- 4
- 216
- 0
Báo cáo hóa học: " Reduced cytotoxicity of insulin-immobilized CdS quantum dots using PEG as a spacer" pot
... evaluated by two different methods, BrdU assay and morphological observation Figure shows the pattern of fibroblast proliferation as measured by BrdU assay after and 24 h of culture in media containing ... Page of Figure Proliferation of human fibroblasts after and 24 h of incubation In a dish containing CSNPs, PCSNPs, and ICSNPs and in a polystyrene culture dish, as measured by BrdU assay was found ... 2 011 References Pan J, Feng SS: Targeting and imaging cancer cells by folate-decorated, quantum dots (QDs)-loaded nanoparticles of biodegradable polymers Biomaterials 2009, 30 :11 76 Alivisatos AP,...
- 9
- 403
- 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
... able to obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11 ] (cf Remarks 2 .1 and 4.3) Proof of Eilenberg’s ... there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10 ] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... here a direct proof of Theorem 1. 1 Fix an x ∈ X By (i), (x,Fx) ∈ R0 Hence by (1. 1), we may infer that (F n x ,F n +1 x) ∈ Rn for all n ∈ N0 By (iii), we obtain the existence of an x∗ ∈ X such that...
- 6
- 268
- 0
Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot
... sequences [10 ] MRI also has an advantage over laparoscopy for evaluating pelvic and extraperitoneal diseases, as well as lesions concealed by adhesions excision and was involved in editing the manuscript ... deliveries and had no history of abdominal pain, dyspareunia or infertility She was not using any form of hormonal contraception Her medical history was not significant and she never had any abdominal ... presence of endometriotic glands with mucinous type metaplasia and extravasation of the mucinous secretion into the adjacent stroma (Figure 1) No epithelial atypia was seen and the excision appeared...
- 3
- 383
- 0
Báo cáo y học: " Allergic hemiglossitis as a unique case of food allergy: a case report" ppt
... 2006, 16 (6):388-90 Page of (page number not for citation purposes) Journal of Medical Case Reports 2008, 2: 71 http://www.jmedicalcasereports.com/content/2 /1/ 71 Flaitz CM, Chavarria C: Painful tongue ... from the patient for publication of this case report and accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal References Martínez Alonso ... Rhinol Laryngol 2003, 11 2(7):6 51- 3 Chavanne L: (Case of allergic hemiglossitis) s.l.: JFORL J Fr Otorhinolaryngol Audiophonol Chir Maxillofac 19 72, 21( 1): 71 Publish with Bio Med Central and every...
- 3
- 283
- 0
Dirty industry migration and the environment china as a major case for study
... in China 307 x List of Symbols APEC Asian and Pacific Economic Cooperation APL Administrative Procedure Law of PRC (19 89) ASEAN Association of Southeast Asian Nations ASRCC Annual Statistics ... many academic staff of the Faculty of Law, National University of Singapore, notably Prof Tan Khee Jin, Alan, Professor Teo Keang Sood, Prof Thio Liann, Associate Prof Lim Chin Leng, Associate ... Environmental Law Vol 16 No 2, at 15 7 and Wang Canfa et al (Eds), Studies on Environmental Pollution Disputes in East Asia: Cases from Mainland China and Taiwan (Japan: Institute of Developing...
- 412
- 903
- 0
Báo cáo khoa học: "CASE ROLE FILLING AS A SIDE EFFECT OF VISUAL SEARCH" pdf
... fully i n s t a n t ~ a t e d Form using case frames, e.g as part of a semantic net or frame hierarchy In contrast, the G,,rman language dialog system HAM-ANS (Hamburg application oriented natural ... s • path: instrumeht:] Fig 3: Case frames f o r verbs o f type ' t o stop Frames i n FRL a r e passive data structures, whereas flavors can be (re-)activated, c r e a t e d and m o d i f i e ... REPRESENTATION FORMALISMS FOR THE SEMANTICS OF LOCOMOTION VERBS 3 ,1 THE REPRESENTATION LANGUAGES SURF AND DEEP A case f r a m e i s r e p r e s e n t e d as a combination of deep case descriptions specifying...
- 8
- 424
- 0
báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx
... Pamidronate (Aredia) and zoledronate (Zometa) induced avascular necrosis of the jaws: a growing epidemic J Oral Maxillofac Surg 2003, 61( 9) :11 15 -11 17 Advisory Task Force on Bisphosphonate-Related ... of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association of Oral and Maxillofacial Surgeons position paper on bisphosphonate-related osteonecrosis of the jaws ... as: Otto et al.: Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report Journal of Medical Case Reports 2 011 5:477 ...
- 4
- 233
- 0
Báo cáo y học: " Cholestatic hepatitis as a possible new side-effect of oxycodone: a case report" pptx
... concerns as he was symptom free and there was a considerable risk of inducing fulminant hepatic failure Conclusion In summary, we report a potential case of cholestatic hepatitis as a consequence of ... cholangiopancreatography confirmed the presence of gallstones but was otherwise unremarkable with no ductal dilatation A liver biopsy was performed and was striking for the presence of canalicular ... prophylaxis Propofol 860 mgs and Fentanyl 3000 micrograms were given as an infusion during and after the operation Ketamine 600 mgs was administered via intravenous infusions for analgesia The infusions...
- 4
- 213
- 0
Báo cáo y học: " Glucocorticoid hypersensitivity as a rare but potentially fatal side effect of paediatric asthma treatment: a case report" doc
... significant increase in CD63-positive basophils as compared with controls In contrast, additional incubation of basophils with prednisone, betamethasone and dexamethasone did not elicit any significant ... dexamethasone (Fortecortin™) While fluorescence enzyme immunoassay (FEIA) analysis revealed no specific IgE antibodies against PSH, CD63-based basophil activation testing with PSH induced a significant ... was administered intravenously Within a few minutes the boy developed generalized urticaria, facial angio-oedema, nausea and severe dyspnoea requiring nasal oxygen supplementation PSH medication...
- 3
- 213
- 0
Tài liệu Báo cáo khoa học: How to remain nonfolded and pliable: the linkers in modular a-amylases as a case study ppt
... yasara (http://www yasara.org/) and psi-blast [35], as well as pep-fold [26] As pep-fold can deal with a maximum length of 25 amino acids, the whole structure of larger linkers was built manually ... psychrophile Alteromonas haloplanctis J Biol Chem 273, 12 109 12 115 35 Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W & Lipman DJ (19 97) Gapped BLAST and PSI-BLAST: a new generation of ... 6.5 5.3 1. 1 2.9 6.9 7 .1 4.2 2 .1 5.0 0.6 4.5 14 .3 4.3 1. 5 3.7 5.4 10 .4 1. 3 1. 7 12 .1 6.9 5 .1 0.3 1. 4 8.0 a Data for 833 amino acids in the 31 linkers shown in Fig b Data from ref [13 ] c Data from...
- 8
- 624
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... Petersburg, FL, USA) followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned ... cells affecting the 5E1 epitope Gup1 acts as a negative regulator for N-terminal palmitoylation of Shh Mammalian Gup1 has been described in the gene database cited above as a homolog of the S ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon...
- 14
- 499
- 0
Tài liệu The Value of the Case Study as a Research Strategy doc
... organizational theory rely heavily upon the case study as a form of data collection and even as a type of unstructured analysis: As a form of research, the case study is unparalleled for its ability ... multiple sources of information as embedded cases He cautions that embedded cases may be mistakenly classified as holistic cases if a single source has identifiable sub-units - a holistic case design ... single case or use a number of cases: A single case may form the basis of research on typical, critical or deviant cases, while multiple cases may be used to achieve replication of a single type of...
- 15
- 587
- 0
TUBERCULOSIS PNEUMONIA AS A PRIMARY CAUSE OF RESPIRATORY FAILURE-REPORT OF TWO CASES pdf
... air After a week, he had high grade fever and found to have urinary tract infection and cholelithiasis He was treated for urinary tract Fig 1a: CXR-PA view on admission revealing poorly defined ... by nasal canulae revealed a pH of 7.406, an arterial oxygen pressure (PaO2) of 45.3 mm Hg; and arterial carbon dioxide tension (PaCO2), 56.6 mm Hg PaO2 / FiO2 ratio of 14 2 Gradually, he was able ... revealed: pH, 7.4 71; PaO2 of 67.5 mm Hg; PaCO2 of 37 .1 mm Hg His hospital stay was 11 1 days DISCUSSION Identification of the primary cause of respiratory distress is vital for the initiation of appropriate...
- 7
- 352
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... cells Proc Natl Acad Sci USA 91, 7 311 –7 315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... GAAGAAGAA UAGAAGAAGAA 4995–5 017 [5, 12 , 38, 40] 5362–5366 5428–5437 5 418 –5437 5558–5582 8047–8062 [48, 41, 15 , 17 , 8] A3 A5 A7 ISS ESE3 The HIV -1 encoded proteins Tat, which acts as a transactivator...
- 10
- 434
- 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx
... result of the fact that inflammatory transcription factors such as nuclear factor-kappaB, activator protein -1 and nuclear factor of activated T-cells are positively regulated by PARP -1 PARP -1 protein ... PARP -1 and the ischemic neurovascular unit Astrocyte PARP -1 Neuron Inflammatory mediators AIF PARP -1 M ina am ll asa P M PARP -1 B HM G B1 M P M HM GB M P M X Endothelium X PM TR Ca2+ Inflammatory ... basal PARP -1 activity as central to homeostatic regulation of endothelial function, whereas its hyperactivation appears causal to BBB damage and immune cell infiltration during ischemia PARP -1, ...
- 10
- 417
- 0
Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt
... of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic reaction was shown to consist of a rapid ... initial reaction followed by a slower second phase over a wide pH range from 5.3 to Tsuruga and Shikama [ 21] confirmed that the fast phase of oxidation was due to the a chains and the slow phase was ... initial fast phase, i.e oxidation of the a chains The rates of oxidation are reduced in the presence of chelators of heavy metal cations in most cases An exception is the lack of alteration of the...
- 6
- 748
- 0
Improving Medical Decisions Through Comparative Effectiveness Research: Cancer as a Case Study pot
... not as detailed and not as expensive to generate as clinical databases, are another potentially valuable source of information on health outcomes and associated factors Private insurers such as ... Health Affairs 24 (1) :12 8 -13 2, January/February 2003 (accessed February 22, 2009) 19 ... COMPARATIVE EFFECTIVENESS RESEARCH: CANCER AS A CASE STUDY new cancer drug, for example, are often conducted in cancer patients whose cancer has spread to other organs (metastasized) In cancer patients...
- 31
- 317
- 0
BROADBAND AS A COMMODITY: HONG KONG, CHINA INTERNET CASE STUDY docx
... September 19 91 ADSL launched May 19 98 First commerical ISPs, late 19 93 0 .1 0.9 1. 4 19 91 1992 19 93 19 94 10 .0 Broadband subscribers per 10 0 inhabitants 14 .0 12 .3 9.3 5.9 0.2 19 96 19 97 0.5 19 98 19 99 ... 2002 as well as articles and reports noted in the document The assistance of the Office of the Telecommunication Authority, particularly M H Au and Sara Lam, was indispensable and highly appreciated ... population, age five and over, able to speak English, 20 01 and i-Cable broadband portal Percentage of population able to speak English Not able 57% As usual language 3% As another language 40%...
- 38
- 222
- 0
Báo cáo khoa học: PCSK9 is phosphorylated by a Golgi casein kinase-like kinase ex vivo and circulates as a phosphoprotein in humans doc
... 0 11 000 12 500 SO42– 10 10 11 000 12 500 11 000 12 500 12 000 14 000 12 000 14 000 12 000 Mass/charge (m/z) 14 000 12 000 14 000 SO42– 13 827.9 Da (13 835.5 Da) 13 782.9 Da (13 777.5 Da) 13 775 .1 Da (13 777.5 Da) ... Mass/charge (m/z) 11 000 12 500 12 000 14 000 SO42– 13 782.9 Da (13 792.5 Da) 13 822.2 Da (13 8 21. 5 Da) 13 822.3 Da (13 8 21. 5 Da) 13 853.3 Da (13 849.5 Da) PO42– 13 864.0 Da (13 872.5 Da) 13 898.8 Da (13 9 01. 5 ... sulfation of the prodomain, the common naturally occurring A5 3V variation that has no significant effect on plasma cholesterol levels and the R46L variation, a naturally occurring variant associated...
- 14
- 454
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25