quantitative analysis of thin specimens at highvoltages

Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc

Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc

... superposition of the exponential rise to analyze quantitatively the contribution of each phase The amplitude and rate constant of each of the three phases can be calculated by deconvolution of the traces ... approximation of FI traces and to quantitatively estimate the contribution of each phase The average values of amplitudes and half-times (t1 2) found for each phase of the FI measured at a light ... we show FI traces for untreated thylakoids incubated at the maximal and minimal temperaTable Quantitative analysis of uorescence induction (FI) in spinach thylakoids at 21 C FI traces were tted...

Ngày tải lên: 19/02/2014, 05:20

8 712 0
Tài liệu ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE AND ACCOUNTING Essays in Microstructure in Honor of David K. Whitcomb Volume 3 ppt

Tài liệu ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE AND ACCOUNTING Essays in Microstructure in Honor of David K. Whitcomb Volume 3 ppt

... Advances in Quantitative Analysis of Finance and Accounting is an annual publication designed to disseminate developments in the quantitative analysis of finance and accounting The publication is ... ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE AND ACCOUNTING Essays in Microstructure in Honor of David K Whitcomb Volume This page intentionally left blank ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE ... Journal of Finance, The Journal of Financial Economics, The Journal of Financial & Quantitative Analysis, The Journal of Industrial Economics, The Journal of Money, Credit & Banking, The Journal of...

Ngày tải lên: 19/02/2014, 13:20

269 1,1K 0
Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx

Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx

... aggregate analysis of Bulgarian dialects In this section more information on the data set used in the project, as well as on the process of the aggregate analysis will be given 3.1 Data Set The data ... successful in the analysis of the dialect variation, all of them aggregate over the entire available data, failing to extract linguistic structure from the aggregate analysis Two attempts to overcome ... reconstruction of the proto-languages from cognates In Chapter the focus is on the automatic determination of sound correspondences in bilingual word lists and the identification of cognates on the basis of...

Ngày tải lên: 20/02/2014, 12:20

6 651 0
Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

Tài liệu Báo cáo Y học: The RuvABC resolvasome Quantitative analysis of RuvA and RuvC assembly on junction DNA doc

... Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA AGAAGCTCCATGTAGCAAGGCTAG ... Bio-AATGCTACAGTATCGTCCGGTCACGTACAACATCCAG CTGGATGTTGTACGTGACCGGACGATACTGTAGCATT Bio-GTACGAGCAGCTCCCGGGTCAGTCTGCCTA TAGGCAGACTGACCCGGGAGCTGCTCGTAC Bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT ... co-operative mechanism with an overall Kd of approximately 0.2 nM and also demonstrate the formation of a RuvA/C complex on the Holliday junction MATERIALS AND METHODS Synthesis and purification of...

Ngày tải lên: 21/02/2014, 01:21

10 673 0
Báo cáo khoa học: Quantitative analysis of ultrasensitive responses pot

Báo cáo khoa học: Quantitative analysis of ultrasensitive responses pot

... that the relative amplification approach allows quantitative analysis of local and global sensitivities, even if the shape of the response under consideration deviates from that of the Hill equation ... that the Hill approach is inappropriate for the quantitative analysis of sensitivity if a response consists of two parts that differ in their steepness relative to the Michaelis–Menten equation ... depends on the ratio of maximal and basal activation, so that the impact of basal activation on the sensitivity can easily be analyzed As an example, the relative amplification plots of the Michaelis–Menten...

Ngày tải lên: 07/03/2014, 21:20

9 443 0
Báo cáo khoa học: "A Comparison and Semi-Quantitative Analysis of Words and Character-Bigrams as Features in Chinese Text Categorization" potx

Báo cáo khoa học: "A Comparison and Semi-Quantitative Analysis of Words and Character-Bigrams as Features in Chinese Text Categorization" potx

... division at -1.4 12 Overall Information Quantity of a Feature Space The performance limit of a classification is related to the quantity of information used So a quantitative metric of the information ... reported to be better in Chinese text categorization by a cen- The Annual Evaluation of Chinese Text Categorization 2004, by 863 National Natural Science Foundation In the original document collection, ... is one of the best word segmentation systems (SIGHAN 2003) and reaches a segmentation precision of more than 97%, so we choose it as a representative of state -of- the-art schemes for automatic word-indexing...

Ngày tải lên: 08/03/2014, 02:21

8 493 0
ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE AND ACCOUNTING Volume 4 doc

ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE AND ACCOUNTING Volume 4 doc

... Advances in Quantitative Analysis of Finance and Accounting is an annual publication designed to disseminate developments in the quantitative analysis of finance and accounting The publication is ... form of Model suggests that the contribution of various terms of the valuation function will vary with the efficiency of operations, as proxied by profitability, q, of the firm Analysis of the ... firm profitability as a proxy for firm efficiency and leads naturally to stratification of samples for empirical analysis The use of accounting profitability for stratification has shown that this...

Ngày tải lên: 23/03/2014, 12:20

376 559 3
ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE AND ACCOUNTING Volume 5 potx

ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE AND ACCOUNTING Volume 5 potx

... the quantitative analysis of finance and accounting The publication is a forum for statistical and quantitative analyses of issues in finance and accounting as well as applications of quantitative ... ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE AND Accounting June 8, 2007 3:16 spi-b483 Advances in Quantitative Analysis of Finance and Accounting: Vol.5 Advances in Quantitative Analysis of Finance ... Advances in Quantitative Analysis of Finance and Accounting: Vol.5 Preface Advances in Quantitative Analysis of Finance and Accounting is an annual publication designed to disseminate developments...

Ngày tải lên: 23/03/2014, 12:20

345 704 1
ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE AND ACCOUNTING Volume 6 pot

ADVANCES IN QUANTITATIVE ANALYSIS OF FINANCE AND ACCOUNTING Volume 6 pot

... the quantitative analysis of finance and accounting The publication is a forum for statistical and quantitative analyses of issues in finance and accounting as well as applications of quantitative ... Advances in Quantitative Analysis of Finance and Accounting: Vol.6 Preface to Volume Advances in Quantitative Analysis of Finance and Accounting is an annual publication designed to disseminate developments ... in Quantitative Analysis of Finance and Accounting: Vol.6 List of Contributors xi Ray J Pfeiffer, Jr Isenberg School of Management Department of Accounting and Information Systems University of...

Ngày tải lên: 23/03/2014, 12:20

270 374 1
Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot

Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot

... classification accuracies can be attributed to a small number of features or are rather the cumulative effect of a high number of them In Table we apply the two feature selection criteria that were ... male indicators Our analysis also reveals that a high number of useful features are names A possible explanation is that people usually introduce themselves at the beginning of the conversation In ... classification accuracy of 66.4%, which shows that the number of irrelevant features is rather small, about 5K features It is also instructive to see which features are most discriminative for...

Ngày tải lên: 31/03/2014, 03:20

8 347 0
báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx

báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx

... training enrolment, graduation rates, public sector entry rates of graduates, and attrition rates HRH projection model Our HRH projection model uses Excel (Microsoft Office, Microsoft; 2007) to forecast ... graduates of training institutions at current rates if the number of graduates grows Historically, international monetary Page of 10 institutions have imposed limitations on the expansion of the ... reducing attrition and increasing the graduation and public sector entry rate of doctors by 2010 Without changes in current levels of attrition, graduation and public sector entry rates, training...

Ngày tải lên: 18/06/2014, 17:20

10 428 0
Báo cáo sinh học: "A quantitative analysis of the mechanism that controls body size in Manduca sexta" docx

Báo cáo sinh học: "A quantitative analysis of the mechanism that controls body size in Manduca sexta" docx

... integration of Equations (3) and (8), using time steps of one half hour (or less) and keeping track of the time at which the critical weight is attained (at which time Equation (8) replaces Equation ... character of this relationship is due to the gating of PTTH secretion As the growth rate increases, the time of PTTH secretion occurs progressively earlier in a gate, until the beginning of that gate ... achieved at the time ecdysone is secreted fully determines the body size of the adult Our quantitative analysis of the processes that lead to the secretion of ecdysone produced a simple mathematical...

Ngày tải lên: 06/08/2014, 18:21

15 356 0
Báo cáo lâm nghiệp: "Environmental risk assessment based on semi-quantitative analysis of forest management data" pptx

Báo cáo lâm nghiệp: "Environmental risk assessment based on semi-quantitative analysis of forest management data" pptx

... evaluation of logistic regression models (e.g M et al 2005) RESULTS The quality of the derived models as indicated by the ratios of residuals and degrees of freedom was satisfactory The ratios ... calibration data (Table 5) No over- or underestimation was detected in the Orava region, where the ratio of risk category to category was nearly 1:2 Underestimation by about 13% was detected for category ... possibility of under- or overestimation of predicted risk given unbalanced data sets, i.e when one risk category prevails over another at a ratio lower than 1:3 Table Classification matrices expressing...

Ngày tải lên: 07/08/2014, 10:21

7 386 0
Báo cáo khoa học: "Immunohistochemical identification and quantitative analysis of cytoplasmic Cu/Zn superoxide dismutase in mouse organogenesis" ppsx

Báo cáo khoa học: "Immunohistochemical identification and quantitative analysis of cytoplasmic Cu/Zn superoxide dismutase in mouse organogenesis" ppsx

... polycarbonate cages and acclimatized for wk The environmental conditions o were controlled, with an ambient temperature of 21 ± C, relative humidity of 55% ± 10%, air ventilation rate of 10 cycles per h, ... μg/ml aprotinin, 0.5 mM sodium orthovanadate, and 20 mM sodium pyrophosphate) The lysates were clarified by o centrifugation at 14,000 rpm for 10 and incubated at 95 C in loading buffer (0.125 M Tris-HCl ... a 20 incubation in diluted o normal serum, and sections were incubated for h at 37 C with the SOD1 antibody Next, sections were incubated for 30 at room temperature with a biotinylated secondary...

Ngày tải lên: 07/08/2014, 20:23

8 412 0
Báo cáo y học: "Quantitative analysis of histone exchange for transcriptionally active chromatin" pdf

Báo cáo y học: "Quantitative analysis of histone exchange for transcriptionally active chromatin" pdf

... the application of I-DIRT technology to determine the level of histone dissociation/ re-association during chromatin purification [11] In this report, we have applied additional bioinformatic analyses ... the isolation of isotopically light histones) was followed with mass spectrometry Mascot analysis of the mass spectrometric data obtained from H2B-TAP cells treated with increasing amounts of formaldehyde ... purification, which was not observed at elevated levels of cross-linking We predict that cross-linking more readily stabilizes densely packaged areas of chromatin like heterochromatin, while leaving less...

Ngày tải lên: 10/08/2014, 09:22

5 267 0
Báo cáo y học: "Quantitative analysis of residual protein contamination of podiatry instruments reprocessed through local and central decontamination units" docx

Báo cáo y học: "Quantitative analysis of residual protein contamination of podiatry instruments reprocessed through local and central decontamination units" docx

... However, national strategies have favoured a predilection towards the centralisation of sterile services and the reprocessing of instruments at a central decontamination unit (CDU) [7] CDU’s offer ... with greater quantitative sensitivity have emerged Examples include a fluorescent microscopy technique involving visualisation of protein by SYPRO ruby staining capable of detecting 85 pg of protein ... study has shown that overall, the CDU is superior to the LDU with respect to podiatry instrument reprocessing and that the level of complexity of the instrument may dictate the level of reprocessing...

Ngày tải lên: 10/08/2014, 21:24

7 294 0
báo cáo khoa học: "Quantitative analysis of nanoparticle internalization in mammalian cells by high resolution X-ray microscopy" pps

báo cáo khoa học: "Quantitative analysis of nanoparticle internalization in mammalian cells by high resolution X-ray microscopy" pps

... Quantitative uptake, quantitative cell death rate and colloid concentration appear all correlated Quite interestingly, no particle uptake was found at cell nuclei locations This indicated that the nuclear ... reliable quantitative information The results presented below show that the extraction of detailed quantitative data on nanoparticle cellular uptake is entirely feasible Although so far validated ... however, limitations in the quantitative data that can be extracted with TEM The images of Figure are from very thin slices of cells hundreds time thicker, and essentially yield 2D information Three-dimensional...

Ngày tải lên: 11/08/2014, 00:23

15 351 0
báo cáo khoa học:" Quantitative analysis of the epithelial lining architecture in radicular cysts and odontogenic keratocysts" doc

báo cáo khoa học:" Quantitative analysis of the epithelial lining architecture in radicular cysts and odontogenic keratocysts" doc

... has been mathematically modelled [14] Obviously these models are abstractions of natural processes which are based on quantitative characterisation of features which, in turn, are translated into ... value (the discrimination rates, however, were not reported) Another study of 328 cysts (site-matched) found that a number of histological features (namely the number of satellite cysts, solid ... indicate that there is little or no information provided for discrimination purposes by the morphological analysis However, it could be possible that positional (architectural) information associated...

Ngày tải lên: 11/08/2014, 23:22

9 244 0
báo cáo khoa học: " Mechanistic insights from a quantitative analysis of pollen tube guidance" ppsx

báo cáo khoa học: " Mechanistic insights from a quantitative analysis of pollen tube guidance" ppsx

... gradient of an attractant by sensing a change in the concentration of the attractant across their tips To explore the implications of these results, we developed a mathematical model of pollen ... slope A of each regression model (Fig 3C), is a measure of the pollen tube response at that distance and incubation time, and also provides an estimate of the size of the gradient of the attractant ... with the locations of the micropyles of the ovules to give distance and angle data, and data from stigmas with the same incubation time were combined To assay the amount of attraction that pollen...

Ngày tải lên: 12/08/2014, 03:21

20 309 0
Báo cáo khoa học: "A quantitative analysis of the acidosis of cardiac arrest: a prospective observational study" pdf

Báo cáo khoa học: "A quantitative analysis of the acidosis of cardiac arrest: a prospective observational study" pdf

... so treated) because of the logistic difficulty of collecting such detailed information while attempts were being made to save the life of the patients This is a significant limitation of our ... analyzed the cause of metabolic acidosis in these patients We therefore sought to define and quantify acid–base status in these patients by applying the quantitative Hyperphosphatemia in patients with ... Hyperphosphatemia is also related to other types of metabolic acidosis [27,28] However, because phosphate is not included in calculations of the anion gap, its impact on acid–base status is often...

Ngày tải lên: 12/08/2014, 22:22

6 289 0
w