qlh 108 110 for perv a binding and infection

... (2-5OAS) pathway that typically results in RNAseL activation and cleavage of viral doublestranded RNA Vertical lines within RNaseL indicate ankyrin repeats Right panel illustrates the double-stranded ... translation, encapsidation, or both? In the cytoplasm, the retroviral primary transcript (premRNA) plays a dual role as unspliced mRNA template for translation and as genomic RNA that is encapsidated ... transactivation response element (TAR) RNA binding protein (TRBP), Tat, and 2-5OAS proteins are marked Tat 86 and Tat 72 indicate the 86 amino acid and 72 amino acid isoforms of HIV-1 Tat Circles labeled...

Ngày tải lên: 13/08/2014, 05:21

... analysis and inferential statistics, careful preparation of the data and choice of the appropriate statistical measures are key We illustrate the data and the measures used here 2.1 In this paper, ... verbs; Goal and Beneficiary can be passivised and undergo the dative alternation; Instrument and Comitative are expressed by the same preposition in many languages (see Levin and Rappaport Hovav (2005).) ... grammaticalise aspects of mean- Data and Semantic Role Annotation Proposition Bank (Palmer et al., 2005) adds Levin’s style predicate-argument annotation and indication of verbs’ alternations to...

Ngày tải lên: 20/02/2014, 07:20

... “Mr and Mrs Smith”, “Mr And Mrs Smith”, and so on To deal with these aliasing forms, we transform all different forms into a standard form for the later ranking and identification The standard form ... translation is easier than backward translation On the one hand, there is no unique answer to forward translation Many alternative ways can be adopted to forward translate an NE from one language ... nominated We call the translation of an NE along the tree downward as a “forward translation” On the contrary, “backward translation” is to translate an NE along the tree upward we find translations...

Ngày tải lên: 20/02/2014, 12:20

... Charniak parser as described above, and performed forest-based rule extraction (Mi and Huang, 2008) with a maximum height of nodes We used the same features as Mi and Huang (2008) The language ... labeled-bracket F1, and find that, in this case, the translation model does indeed select parses that are better on average NIST 2003 Table 1: Data used for training and testing the parsing and translation ... Proc ACL 2007, pages 704–711 Haitao Mi and Liang Huang 2008 Forest-based translation rule extraction In Proc EMNLP 2008, pages 206–214 Haitao Mi, Liang Huang, and Qun Liu 2008 Forestbased translation...

Ngày tải lên: 30/03/2014, 17:20

... the first human-to-human transplantation was performed in South Africa by Christiaan Barnard, and the first transplantation in the United States, performed by Norman Shumway at Stanford Uni- versity, ... Massachusetts Medical Society All rights reserved PE R S PE C TI V E taking heart — cardiac transplantation past, present, and future A Standard (Biatrial) Heart Transplantation Left subclavian ... et al ACC/AHA guidelines for the management of patients with ST-elevation myocardial infarction: a report of the American College of Cardiology/American Heart Association Task Force on Practice...

Ngày tải lên: 27/06/2014, 00:20

... the ultrastructural appearance of mast cells in asthmatic airways often indicates a process of piecemeal degranulation rather than the anaphylactic degranulation evident after allergen challenge.11 ... normal human airways, but in asthma, they migrate into three key structures: the airway epithelium,8 the airway mucous glands,2 and the ASM.51 This anatomical relocation places activated mast ... Bradding, Mast Cells and Eosinophils in Asthma damaged epithelium post-mortem,17 suggesting that airway eosinophils are activated and may be an important mediator of epithelial damage Eosinophils...

Ngày tải lên: 08/08/2014, 21:20

... important because overhydration may add to morbidity, partly because it prolongs the need for mechanical ventilatory support and the time needed to regain negative fluid balances and mobilization ... EVLW has been validated against gravimetric techniques in experimental animals [12] Groeneveld AB, Verheij J: Is pulmonary edema associated with a high extravascular thermal volume? Crit Care Med ... transpulmonary thermodilution, which is feasible nowadays [2], can help to manage patients with ALI/ARDS on mechanical ventilation, and can help to decide on withholding intravenous fluids and...

Ngày tải lên: 12/08/2014, 20:21

... It is the event a lot A has been talked about B that has been talked about C Has talked about D that has talked about She hard but also gets on well with her classmates A doesn’t only study ... tennis match _ players played well It wasn’t a good tennis match _ player played well “Is your friend Canadian or American? _ she’s Australian.” We went away for two days But the weather ... the mountain and he can’t EITHER * I wasn’t at the beauty contest and NEITHER was she * Thuy didn’t have her hair cut, NEITHER did her brother * A: I shan’t go overseas next month B: I shant’t EITHER/...

Ngày tải lên: 07/06/2015, 03:00

... and Van Praag, 2012) and familiarity (Bel, Smirnov and Wait, 2015) Another characteristic in which employees differ is the length of contracts Some employees have a permanent contract (contract ... productivity increases, because he can always at least the same effort as without the investment and receive a higher pay-off But because the other player plays a trigger-strategy, the necessary effort to ... work in teams of agents Three team compositions are possible: a team with two P agents (PP), a team with two T agents (TT) and a mixed team with one P agent and one T agent (PT) A principal is responsible...

Ngày tải lên: 30/09/2015, 06:41

... 1992 Example-Based Transfer of Japanese Adnominai Particles into English IEICE Transactions on Information and Systems, E75-D, No 4, pages 585-594 Y Wakita, J Kawai, and H Iida 1997 Correct parts ... well-formed parts and ill-formed parts Item (C) splits input into well-formed parts and ill-formed parts, and enables parsing in such cases where the input is ill-formed or the translation rules are ... has more syntactic and semantic relations than a set of fragmental expressions, in general, the translation of a global expression tends to be better than the translation of a set of fragmental...

Ngày tải lên: 08/03/2014, 05:21

... Chinese Translation Evaluation Automatic MT evaluation aims at formulating automatic metrics to measure the quality of MT output Compared with human assessment, automatic evaluation metrics can assess ... datasets, in the spoken language translation domain and the newswire translation domain The IWSLT'08 English-to-Chinese ASR challenge task evaluated the translation quality of machine translation ... Intrinsic and Extrinsic Evaluation Measures for Machine Translation and/ or Summarization, pages 65-72, Ann Arbor, Michigan, USA Chris Callison-Burch, Cameron Fordyce, Philipp Koehn, Christof Monz and...

Ngày tải lên: 17/03/2014, 00:20

... aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and 5' tgccccgtgtgaggatcgaactcacg accttcagattatgagactgacgcgctacctactgcgctaacgagg (tRNAMet(e)); 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg 3' and 5' tagcagaggatggtttcgatccatcg ... sequence for T7 promoter: 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgatgctctaccgactgagctatccgggc 3' (tRNALys,3); 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg ... A C t6 C A C A U tRNA B Provirus A- loop PBS HXB2WT 5’ TTTTAGTCAGTGTGG AAAA TCTCTAGCAG TGGCGCCCGAACAGGGAC TTGAAAGCG … 3’ HXB2Met(e) 5’ TTTTAGTCAGTGTGG AAAA TCTCTAGCAG TGGTGCCCCGTGTGAGGA TTGAAAGCG...

Ngày tải lên: 13/08/2014, 09:20

... events and they like team games (not only but also) I didn’t have to go to school last Sunday He didn’t have to go to school last Sunday (neither nor) That boy was dirty, and he was lazy, too ... sure I think it was _ Michael _ Paul A both – and B either – or C neither – nor D not only – but also 10 _ Linda _ Helen called to say sorry I'm very sad and frustrated A Both – and B Either ... C at all D always 26 He neither drank smoked, so he had good health A nor B or C but D also 27 Now women work both before after having their children A or B also C nor D and 28 She hard...

Ngày tải lên: 18/05/2015, 12:00

... not only read the book but also remembered what he had read => Not only She can’t write fast She can’t type => She can’t either ……………………………………………………………… Dick doesn’t need a bike He ... stay at home => They won’t either …………………………………………………………… I didn’t have to go to school last Sunday He didn’t have to go to school last Sunday => Neither ……………………………………………………………………… Mary hasn’t ... studied Spanish Her friend hasn’t studied Spanish => Neither ……………………………………………………………………… 10 They didn’t like music They didn’t like sports => They like ……………………………………………………………………… 11 He isn’t a doctor...

Ngày tải lên: 27/06/2015, 04:00

Ngày tải lên: 13/11/2015, 10:03

... bảng NAT, NAT thay đ a đích đ a inside local từ bảng NAT +> Router tìm kiếm bảng NAT để tìm đ a outside global với đ a nguồn gói tin Nếu có hàng tìm thấy, NAT thay đ a đích đ a outside local từ ... dịch đ a thực công thức đơn giản: Đ a đích =Đ a mạng OR (đ a nguồn AND ( NOT netmask)) Ví dụ : Một đ a private map với đ a public Ví dụ máy trọng mạng LAN có đ a 10 1 “phiên dịch” thành đ a public ... tất packet với Destination IP= Local IP Destination port nằm tầm port cho phép NAPT phải demasqueraded (phân giải packet masqueraded) Thực chất việc thay đổi destination address source address...

Ngày tải lên: 15/08/2012, 10:40

... Pause when formulating  judgment   Understand what was meant by  actions or words  Reflect on information and ask  for additional information  Reinterpret by applying an  alternate explanation ... Seek advancement on less contentious issues and return to  others later Reposition or frame in positive, mutual­gain terms Frame differences as natural  Find common ground through value linking Emphasize what has been accomplished Encapsulate conflict issues ... Explore whether conflict is a signal for a change  View the disagreement as a choice  point and explore options for moving  forward – what comes next?  Utilize framing Identify Compatible Interests  Focus on commonality rather than ...

Ngày tải lên: 22/08/2012, 22:07

... relatively straightforward to take a large set of Web pages labeled as positive and negative examples of the concept “home page” and derive a classifier that predicts whether any given Web page is a home ... COMMUNICATIONS OF THE ACM in part by Office of Naval Research grant 92-J-1946, by ARPA / Rome Labs grant F30602-95-1-0024, by a gift from Rockwell International Palo Alto Research, and by National ... Erik Selberg, Richard Segal, and Jonathan Shakes Thanks are due to Steve Hanks and other members of the UW AI group for helpful discussions and collaboration This research was funded 68 November...

Ngày tải lên: 31/08/2012, 16:47

... with a proof: that every segment contained by a straight line and by a section of the right-angled cone2 is a third again as much as a triangle having the same base as the segment and an equal ... that diagrams represent in a more pictorial way Thus, for instance, a chord that appears like a diameter could automatically be read by modern readers to signify a diameter, with a possible clash ... language, and the purpose of a scholarly translation as I understand it is to remove all barriers having to with the foreign language itself, leaving all other barriers intact The Archimedean...

Ngày tải lên: 21/09/2012, 11:00

... yourglass, MARCARET: Where's Alana? ALANA:Hereyou are.Thanks That's enough Tara MARTIN: Alana! Margaret! Comeintothe garden Darling Markus and Marsh dancing the grass are on In MARGARET:the darl

Ngày tải lên: 03/10/2012, 15:20