q t given by torsion on elliptic curves

Ngày tải lên: 12/06/2014, 16:12

... R:ctccttaatgtcacgcacgatttc actin2 F:ctacaatgagctgcgtgtggc R:caggtccagacgcaggatggc p15 DNMT1 R:ggtttgacttcggagtctct DNMT3A F:cacacagaagcatatccaggagtg R:agtggactgggaaaccaaataccc DNMT3B F:aatgtgaatccagccaggaaaggc ... for the methylated form of p15 (148pb) were gcgttcgtattttgcggtt (positive sense), and cgtacaataaccgaacgaccga (antisense) The primers for unmethylated form (154 bp) were tgtgatgtgtttgtattttgtggtt ... hypomethylation Whether PHI also bind to DNMTs remains to be investigated The methylation of p15 by PHI could also be related to the PHI effects on histone acetylation Histone acetylation generally...

Ngày tải lên: 10/08/2014, 22:21

... pháp tuyển dụng công ty TNHH đầu t thương mại Q& T Hà Nội Theo số liệu điều tra thu thập kê t quả công tác tuyển mộ đa số ứng viên biê t thông tin tuyển dụng thông qua người thân, quen ... T CH THỰC TRẠNG CƠNG T C TUYỂN DỤNG NHÂN LỰC T I CÔNG TY TNHH ĐẦU T THƯƠNG MẠI Q& T HÀ NỘI 2008 – 2010 2.1 Phân t ch thực trạng công t c tuyển dụng nhân lực công ty TNHH đầu t thương mại Q& T Hà ... khả tham lãnh đạo quản lý phân xưởng Nhận x t: Nhìn chung cơng t c đào t o cơng ty TNHH đầu t thương mại Q& T Hà Nội bám s t vào thực t ho t động sản xu t kinh doanh nhu cầu thi t thực công ty...

Ngày tải lên: 23/07/2013, 15:00

Ngày tải lên: 08/09/2013, 17:10

... chiÕn trờng Câu : nối ngu d t với thù địch Bài t p : trang 68 BTTV Bài giải: a)Trời v t thăm thẳm cao b)M t vầng trăng tròn to đỏ hồng lên chân trời sau rặng tre đen làng xa c)Trăng quầng hạn, trăng ... thu t môn thể thao đợc nhiều ngời bi t ®Õn nh : bè mĐ thÊy ®Êy nhiỊu vËn ®éng viên võ thu t nớc ta mang vinh quang cho đ t nớc Còn nớc tiên tiến t t trẻ em đợc học võ Bài t p (SBTTV5 t p trang 52) ... kì, quốc gia, đ t n- Hoà bình, bình, Bầu trời, mùa thu, m t ớc, T quốc, quê hơng, thái bình, bình yên mẻ t non sông Lên thác xuống ghềnh Thành Nơi chôn rau c t rốn, quê cha đ t tổ, Góp gió thành...

Ngày tải lên: 15/09/2013, 20:10

... People think that Steve stole the money a.People think that the money is stolen b Steve is thought to have stolen the money c.It was thought that Steve stole the money d People are thought that Steve ... that she decided to quit it a wonderful b stressful c interesting d satisfactory 25/Identify the one underlined word or phrase that must be changed for the sentence to be correct Last year ... expression b extinction c exploitation d extension 31/ You _ wash your car I just had it done yesterday a can 't b needn 't c may not d mustn 't 32/ Life on earth would come to an end if the ...

Ngày tải lên: 26/09/2013, 11:10

... left On the train I went to the toilet to change I took off my strained trousers and threw out of the window Then opened the bag to get my new ones, but all I found was a pink woolen sweater! ... sentences is true? A He lived far from the station B A man in front of his house was painting his fence C It didn t take him long to walk to the station D He walked so fast that the red paint splashed ... Do teachers make their students ……………….much homework? A to B doing C D done Câu 27 Many species are threatened in the wild due to habitat ……………… by man A conservation B construction C destruction...

Ngày tải lên: 26/09/2013, 11:10

... women to gymnastics C For people to outdoors gymnastics D For men to gymnastics without equipment 37 Why is dance an important part of gymnastics training? A Because it helps you to be stronger ... Europe in the 19th century C In America in the 19th century D In Asia in the 19th century 36 What did Berlin set up the gymnastics centre for in 1811? A For men to gymnastics with equipment B For ... translate this C If I spoke Korean, I could translate this D If I didn 't speak Korean, I couldn 't translate this 43 I haven 't written to him for a year A I didn 't write to him a year ago D The last...

Ngày tải lên: 26/09/2013, 11:10

... nowhere for the elephants to go Experts say that the Asian elephant population is about 55,000 living on a habitat of about 19,000 square miles (30,400 square kilometers) In contrast to this, the African ... participation D participating 30 “I suggest going to Vung Tau at the weekend.” “- ” A That’s a fine day B That’s a good idea C That’s a good trip D That’s a reason PART III : Reading * Read the passage ... 28 Don t phone Ann now She be having lunch A has to B can C must D might nd 29 The 22 SEA Games consisted of athletes from eleven _ countries A participate B participant C participation D...

Ngày tải lên: 26/09/2013, 11:10

... I first arrived A quite time B a quite time C a time quite D quite a time 38 …………… I like to something completly spontaneous A every so often B every often so C very so often D very often so ... conversation wonders………… , no real communication has taken place A what said the other person B what the other person said C what did the other person say D what was the other person saying 29 Deserts are ... that the meeting will be held tomorrow.” - “ But I…………….” A certain B certainly C am certain D am certainly 42 I can meet you at Central Station Will …………? A convenient for you B that convenient...

Ngày tải lên: 26/09/2013, 11:10

... questions Question 41: No one in the class is taller than Lan A Lan is the tallest student in the class B Lan is the tall student in the class C Lan is the tallest student in class D Lan is tallest ... is pity, then, that the authorities are against busking, and what they can to stop it Buskers may be breaking the law, but I think that most people are glad to have little music to brighten their ... part that needs correction Question 46: By the time babies will be seven months old, they can sit up without A B C support D Question 47: You are always driving your car such fast that you often...

Ngày tải lên: 26/09/2013, 11:10

... durable C They pollute the underground water D They are convenient 39 Why shouldn t we thtow motor oil on the gruond ? A.It poisons the environment B It is a waste of money C It pollutes the ground ... waste The most important hazardous Waste in the homes is batteries When you throw them out with your other Garbage , they break open at the landfill The poison inside them moves through rain water ... and other liqiuds to the bottom of the landfill then it can pollute the natual water in the ground We should sue rechargeable batteries Another hazardous waste in homes is motor oil don t throw...

Ngày tải lên: 26/09/2013, 11:10

... As I get older, I want to travel less ”? A I’m getting older, so I don t want to travel B The more I get old, the less I want to travel C I don t want to travel because of my old age D The older ... interested in environmentalists D environmentalists are interested in 33 Choose a word which has a different stress: A.dedicate B convention C disater D committee 34 Which sentence expresses the ... Complete the sentence with a suitable word or phrase The panda’s …………….habitat is the bamboo forest A nature B natural C naturally D natured 20 This scientist has ……………………all his life to the studying...

Ngày tải lên: 26/09/2013, 15:10

... course that students are required to live in university Câu 10: What is not true about the passage ? A Tutors in the Open University help students with their written work B The state grants money to ... years ago B It's ten years I haven 't gone to the cinema C The last time I went to the cinema was ten years D It was ten years ago I went to the cinema Câu 47: " Please don 't leave until I come ... 31: The Bali Tiger was declared extinct in 1937 due to hunting and habitat loss A diversity B reserve C generation D natural environment Câu 32: It is difficult to predict she will next A that...

Ngày tải lên: 26/09/2013, 15:10

... the design truck combined with the effect of the design lane Combination 3: For both the negative moment between points of contraflexure under a uniform load on all spans, and reaction at interior ... of opposite sign to that of the live load  STI1     STI2   STI3   STI4  :=   STI1 STI2 STI3 STI4  STI5  DC LOADS (non-comp) DW Loads LL + I  STI6  LOCATION self wt other (slab) ... opposite sign to that of the live load  STI1v     STI2v   STI3v   STI4v  :=   STI1 STI2 STI3 STI4  STI5v  DC LOADS (non-comp) DW Loads LL + I  STI6v  LOCATION self wt other (slab)...

Ngày tải lên: 29/09/2013, 12:20

... phận trả lời cho câu hỏi đâu? a) Trần Quốc Khái quê huyện Thường T n, t nh Hà T y huyện Thường T n huyện Thường T n, t nh Hà T y b) Ông học nghề thêu Trung Quốc lần sứ Trung Quốc lần sứ c) Để t ởng ... Luyện t câu Kiểm tra cũ: Kiểm tra cũ: Câu T m t nghĩa với ® t n­íc ? Tr¶ lêi: T cïng nghÜa víi ® t nước là: T quốc; giang sơn; non sông Câu Trong khổ thơ sau v t nhân hoá? Vì sao? Ngoài sông thím ... c) Trong câu Xuống nào, mưa ơi!, t c giả nói với mưa thân m t nào? Luyện t câu Bài 1: Bài 2: Nhân hoá Ôn t p cách đ t trả lời câu hỏi đâu? Ông trời b t lửa Chị mây vừa kéo đến Trăng trốn Trăng...

Ngày tải lên: 04/12/2013, 03:11

... part of a projective system It is therefore useful to maintain the notational distinction between the two The fact that f is ordinary at p implies that Af,n is ordinary, in the sense (1) that it ... note that the map j is T- equivariant, provided that the action of T on the source of j is induced by Albanese functoriality and the action of T on the target of j is induced by Picard functoriality ... with a natural left action of Bp /Q by isometries p × corresponding to conjugation of maximal orders by elements of Bp This action → is transitive on both V (T ) and E (T ) Let R× denote the...

Ngày tải lên: 06/03/2014, 08:21

... C√3 contains no rational points (s /q, t /q) On the other hand, any Pythagorean triple (s, t, q) gives rise to a rational point on the unit circle C1 and so there are plenty of rational points on ... associated with Q

Ngày tải lên: 15/03/2014, 09:20

... Sections and relate Kobayashi’s construction to local units, elliptic units, and L-values Section applies the results of [Ru3] to our situation The proof of the main theorem (restated as Theorem ... multiplication Introduction Iwasawa theory was introduced into the study of the arithmetic of elliptic curves by Mazur in the 1970’s Given an elliptic curve E over Q and a prime p there are two ... L-functions attached to E, (c) the Euler system of elliptic units can be used to show that the (torsion) Iwasawa modules E/C and A have the same characteristic ideal If E has ordinary reduction at...

Ngày tải lên: 28/03/2014, 22:20

... present Rather than tempt uncertain fate by making premature conjectures, let me illustrate two key questions by one concrete example Let E be the elliptic curve XI (1I), given by the equation Take ... theorem we will state is motivated by conjecture 1.13 and the above functional equation for the padic L-function Lp(E/$, s) The functional equation is in fact equivalent to the relation between f g ... description involving just the Galois representations attached to the torsion points on E is that one can then attempt to introduce analogously-defined "Selmer groups" and to study all the natural questions...

Ngày tải lên: 31/03/2014, 16:21