... accountant and an advisor Can I get a loan from any of these new programs? SBA loan programs are available to start-up businesses as well as those that are already established All applicants must ... and to make payroll How long will it take to get a loan? How much can I apply for? You can apply for a loan by talking to a local SBA participating lender today Once SBA receives a complete application ... small business I have only been in business for two years and don’t have three years of financial statements or business history Can I get a loan? Yes, you may qualify for a loan SBA loan guarantee...
Ngày tải lên: 07/03/2014, 02:20
... organizations, and by managers of large multinational companies and international NGOs It is popular with final-year undergraduates and MBA and Master's students of business, management and marketing ... to images that are already familiar, like birds, animals or sports players (Buzan, 19 93) The new information is easier to recall The new information can be 'parked' - as in a Microsoft or Mac 'window' ... institutions, democracy, hierarchies and ways of thinking that have largely proved to be accurate This was because he had knowledge about changes that had already taken place at the time he made his predictions...
Ngày tải lên: 15/03/2014, 15:33
Báo cáo khoa học: "Jointly optimizing a two-step conditional random field model for machine transliteration and its fast decoding algorithm" pdf
... top-10 results for both steps to approximate the Equation 3. 3 P (Aj |S) (3) j=1 The meaning of this formula is that the probability of all the remaining candidates is smaller than the probability difference ... Dong Yang, Paul Dixon, Yi-Cheng Pan, Tasuku Oonishi, Masanobu Nakamura and Sadaoki Furui 2009 Combining a Two -step Conditional Random Field Model and a Joint Source Channel Model for Machine Transliteration, ... Kumar Naskar and Sivaji Bandyopadhyay 2006 A modified joint source-channel model for transliteration, Proceedings of the COLING/ACL, pages 191-198 Bo-June Hsu and James Glass 2008 Iterative Language...
Ngày tải lên: 17/03/2014, 00:20
Business and Economics Q Manual A student guide for producing quality work on time ppt
... databases A wide range of academic-quality documents (especially journal articles) and data (e.g detailed company financial data, market research and analysis) can only be obtained from specialist ... bibliographies Other evaluation criteria that apply to academic journals (as detailed above), such as voice, appearance, publisher and author qualifications and affiliation also apply to academic ... world: Latin America and Carribean (R 1), South Asia (R 2) and Sub-Saharian Africa (R 3) The analysis indicates that the infectious disease situation in Sub-Saharian Africa is much worse than that...
Ngày tải lên: 02/04/2014, 05:21
báo cáo hóa học:" Research Article A Variable Step-Size Proportionate Affine Projection Algorithm for Identification of Sparse Impulse Response" pot
... speech input signals (P = 8) For SPAPA and APA, the constant step size is α = 0 .3, which is suitable for practical application It can be seen that VSS-SPAPA can also quickly track the change in unknown ... signal The proposed VSS-SPAPA can achieve a lower steady-state misalignment than SPAPA, approximate 10 dB improvement was achieved The steadystate misalignment of VSS-APA was the same as that ... proportionate a ne projection algorithm and various definitions of the step- size control matrix of proportionate adaptation In Section 3, a variable step size approach is proposed for PAPA to achieve...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: "CONVERGENCE AND STABILITY OF A THREE-STEP ITERATIVE ALGORITHM FOR A GENERAL QUASI-VARIATIONAL INEQUALITY PROBLEM" doc
... Pure and Applied Mathematics 26 (1995), no 10, 937 –945 A H Siddiqi and Q H Ansari, An algorithm for a class of quasivariational inequalities, Journal of Mathematical Analysis and Applications ... of known and new classes of variational and quasi-variational inequalities as special cases in the literature 6 A general quasi-variational inequality problem A three -step iterative algorithm ... for generalized multi-valued co-variational inequalities in Banach spaces, Functional Differential Equations (2000), no 1-2, 5– 13 (2001) [4] C Baiocchi and A Capelo, Variational and Quasivariational...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo lâm nghiệp: "A two-step mortality model for even-aged stands of Pinus radiata D. Don in Galicia (Northwestern Spain)" doc
... [10] All the trees in each sample plot were labelled with a number The breast height diameter was measured cross-wise A 30 -tree randomised sample and an additional sample including the dominant ... radiata in Galicia Mean, maximum and minimum values and standard deviations (SD) for the main stand variables (for the first and second inventory of the 130 sample plots) are presented in Table I ... the natural mortality process of a fast-growing species like radiata pine in Galicia, although irregular climatic conditions during this period may have effects on mortality rates that are balanced...
Ngày tải lên: 08/08/2014, 01:21
Báo cáo y học: "Metalloproteinase and inhibitor expression profiling of resorbing cartilage reveals pro-collagenase activation as a critical step for collagenolysis" pot
... TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264 CATCATGGGGCATGTTAAACAC ADAMTS-4 GCGCCCGCTTCATCACTG 101 TTGCCGGGGAAGGTCACG ADAMTS-5 AAGCTGCCGGCCGTGGAAGGAA 196 TGGGTTATTGCAGTGGCGGTAGG ADAMTS-8 ... GATGTACCGAGGATTCACCAAGAT 35 6 GCCGGATGCAAGCGTAGT TIMP-4 ATATTTATACGCCTTTTGATTCCT 297 GGTACCCGTAGAGCTTCCGTTCC α2 M GCCCGCTTTGCCCCTAACA 35 9 TCGTCCACCCCACCCTTGATG RECK GTAATTGCCAAAAAGTGAAA 35 2 TAGGTGCATATAAACAAGAAGTA ... chain reaction Gene Sequence (5' -3' ) Length (bp) MMP-1 GATGCCGCTGTTTCTGAGGA 37 2 GACTGAGCGACTAACACGACACAT MMP-2 34 7 GCCCCACTTGCGGTCATCATCGTA MMP -3 TTAGAGAACATGGGGACTTTTTG 36 0 CGGGTTCGGGAGGCACAG...
Ngày tải lên: 09/08/2014, 08:22
AN INDUCTIVE POWER TRANSFER SYSTEM WITH a HIGH q RESONANT TANK FOR PORTABLE DEVICE CHARGING
... 2.2 Amp re's Circuital Law and Faraday's Law of Induction There are two basic laws which lay the theoretical foundation of IPT These laws are termed as Amp circuital law and Faraday's law of ... vital role in a transformer For simplification or approximation purpose, it is common to analyze the transformer as an ideal transformer model An ideal transformer is a theoretical, linear transformer ... 2 .3 Magnetic Material Characteristics All materials are influenced to some extent by a magnetic field The overall magnetic behavior of a material can vary widely Several forms of magnetic behavior...
Ngày tải lên: 22/09/2015, 15:19
John Wiley And Sons Complete Q And A Job Interview Book
... Personal and Family Data 15 Chapter Educational Background 31 Chapter Character Traits 45 Chapter Initiative and Creativity 79 Chapter Management Ability 89 Chapter Career Objectives 1 03 Chapter ... roles Straight up An anxious public awaits Roll ’em—and—knock ’em dead! 13 Chapter Personal and Family Data CHAPTER DELIVERY Of all the questions you’ll be asked, personal and family ones appear to ... Educational Background CHAPTER DELIVERY Although not as sensitive an area as personal and family questions, educational questions also cause applicants to trip when they make their grand entrances...
Ngày tải lên: 05/10/2012, 09:47
John Wiley And Sons Complete.Q.And.A.Job.Interview.Book
... Personal and Family Data 15 Chapter Educational Background 31 Chapter Character Traits 45 Chapter Initiative and Creativity 79 Chapter Management Ability 89 Chapter Career Objectives 1 03 Chapter ... roles Straight up An anxious public awaits Roll ’em—and—knock ’em dead! 13 Chapter Personal and Family Data CHAPTER DELIVERY Of all the questions you’ll be asked, personal and family ones appear to ... Educational Background CHAPTER DELIVERY Although not as sensitive an area as personal and family questions, educational questions also cause applicants to trip when they make their grand entrances...
Ngày tải lên: 07/02/2013, 09:37
Lets go 1 A(FOR GRADE 3).ppt
... Weather report It’s sunny It’s cloudy rainny It’s ...
Ngày tải lên: 06/09/2013, 13:10
Writing from start to finish - A six-step guide
... Details, then any Examples Develop a shorthand that works for you—shorten words (for example, char for character), use graphics (for example, sideways arrows to show cause and effect, up and ... Example: Getting ideas for imaginative writing Doing it: Getting ideas for imaginative writing 14 Getting ideas for an essay Making a list Making a cluster diagram Researching Freewriting Example: ... Choosing ideas for an essay Step Three: Outlining About making an outline Making an outline for imaginative writing Making an outline for an essay Step Four: Drafting About writing a first draft First...
Ngày tải lên: 18/12/2013, 18:12
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... 5¢-TCCTTGGTGTCGTATACxxxTCTCTTTCA -3 (xxx ¼ gcg for Arg316 fi Ala, aag for Arg316 fi Lys, ctg for Arg316 fi Leu, and gag for Arg316 fi Glu) Each mutant LBD or full-length ERRc was amplified and cloned into the ... of BPA are observed for both (275Ala)-ERRc and (31 6Ala)-ERRc mutant receptors, and even for (Ala, Ala)-ERRc Discussion Differential capacity of Glu275 and Arg316 to interact with the ligand Fig ... normalization to SEAP activities Each assay was performed in duplicate and repeated at least three times Acknowledgements We thank Professor Ian A Meinertzhagen, Dalhousie University, Canada, for reading...
Ngày tải lên: 18/02/2014, 16:20
Building a Strategic Internal Audit Function: A 10-Step Framework potx
... plan in the organization.” How Do Internal Auditors Add Value?, Internal Auditor Magazine, February, 20 03, page 36 , James Roth, PhD, CIA, CCSA The Outsourcing Dilemma: What’s Best for Internal ... Sarbanes-Oxley Act compliance, fraud investigation and business continuity planning Global Internal Audit Sourcing SarbanesOxley Act Readiness Attack and Penetration Testing Financial Risk Management ... start-up internal audit departments want all staffing and infrastructure in place before beginning to conduct audits This is a major mistake Key stakeholders are impatient for results and want...
Ngày tải lên: 06/03/2014, 19:20
Báo cáo khoa học: "A Two-step Approach to Sentence Compression of Spoken Utterances" pdf
... Meeting on Association for Computational Linguistics, pages 1 73 180, Stroudsburg, PA, USA Proceedings of ACL James Clarke and Mirella Lapata 2008 Global inference for sentence compression an integer ... sentence with that of the first ranked candidate This is because we try to avoid a very large or small compression ratio, and the first candidate is generally a good candidate with reasonable length ... discriminative training to rerank the candidates generated in the first step Reranking has been used in many tasks to find better global solutions, such as machine translation (Wang et al., 2007), parsing...
Ngày tải lên: 07/03/2014, 18:20
Báo cáo khoa học: A guide to taming a toxin – recombinant immunotoxins constructed from Pseudomonas exotoxin A for the treatment of cancer ppt
... the majority of domain Ia (D1–250) and a portion of domain Ib (D365 38 0) from native PE Several RITs incorporating a 38 kDa fragment of PE are in preclinical evaluation or have already reached ... PE38) has undergone several early-phase clinical trials for the treatment of B cell malignancies [35 37 ] These trials have validated the use of CD22 as a target and highlighted several potential ... Pastan 25 26 27 28 29 30 31 32 33 34 35 36 Escherichia coli Proc Natl Acad Sci USA 85, 5879– 58 83 Brinkmann U, Reiter Y, Jung SH, Lee B & Pastan I (19 93) A recombinant immunotoxin containing a...
Ngày tải lên: 22/03/2014, 15:21
WRITING FROM START TO FINISH A SIX-STEP GUIDE doc
... Details, then any Examples Develop a shorthand that works for you—shorten words (for example, char for character), use graphics (for example, sideways arrows to show cause and effect, up and ... Example: Getting ideas for imaginative writing Doing it: Getting ideas for imaginative writing 14 Getting ideas for an essay Making a list Making a cluster diagram Researching Freewriting Example: ... Choosing ideas for an essay Step Three: Outlining About making an outline Making an outline for imaginative writing Making an outline for an essay Step Four: Drafting About writing a first draft First...
Ngày tải lên: 03/04/2014, 12:20
real retouching a professional step-by-step guide
... panels so they can be seen anytime at a glance We also use a graphics tablet and stylus instead of a mouse If you are serious about retouching, you must have a tablet because you cannot accurately ... pasted was the same thing that was already there However, now Ps we have the option to Fade the paste The Fade command fades the last action made in Ps For example, if you apply a blur and want to ... 12-hour days Monday through Friday and eight on Saturday, and I was hollow-eyed and exhausted, I had a message from a New York studio on my answering machine I called them back the next day and convinced...
Ngày tải lên: 31/05/2014, 01:39