putting the circle drawing code into a function

Báo cáo khoa học: The b domain is required for Vps4p oligomerization into a functionally active ATPase potx

Ngày tải lên : 16/03/2014, 13:20

... 5¢-TTAAAAGAACCAGATTAGTCAATTGATTAACGTGCT-3¢ 5¢-AGCACGTTAATCAATTGACTAATCTGGTTCTTTTAA-3¢ 5¢-AAGCAAGAACAGTTCACTGCAGCTTTTGGTCAAGCAGGTAACTAGTCAATTGAT-3¢ 5¢-ATCAATTGACTAGTTACCTGCTTGACCAAAAGCTGCAGTGAACTGTTCTTGCTT-3¢ ... 5¢-GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG-3¢ 5¢-GGGCGGATCCTCTGCTTTTCTTTATC-3¢ 5¢-GCGCTAATGCAACCGTAGTCAATTGATTAACGTGCT-3¢ 5¢-AGCACGTTAATCAATTGACTACGGTTGCATTAGCGC-3¢ 5¢-TTAAAAGAACCAGATTAGTCAATTGATTAACGTGCT-3¢ ... 5¢-GCGCTAATGCAACCGATAGATGTCTCTACGGAGGAC-3¢ 5¢-GTCCTCCGTAGAGACATCTATCGGTTGCATTAGCGC-3¢ 5¢-GACGACGAAACAAGAAAAGATGGCGCCATCGAGATG-3¢ 5¢-CATCTCGATGGCGCCATCTTTTCTTGTTTCGTCGTC-3¢ 5¢-TGCTCTCCAGGTGATGATATTGAAGCTGATGAATTA-3¢...

17
313
0

Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx

Ngày tải lên : 20/06/2014, 22:20

... equation J Inequal Appl 2011 (2011) Article ID 194394 13 Kenary, HA: On the Hyers-Ulam-Rassias stability of a functional equation in non-Archimedean and random normed spaces Acta Universitatis Apulensis ... Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, G: Hyers-Ulam-Rassias stability of the Appollonius quadratic mapping in RNspaces J Nonlinear Sci Appl 4, 110–119 ... for all r, s ∈ K then the function | · | is called a non-Archimedean valuation and the field is called a non-Archimedean field Clearly, |1| = | -1| = and |n| ≤ for all n Î N A trivial example...

14
479
0

an investigation into the meaning and structure of a pictorial story - a systemic functional analysis = nghiên cứu cấu trúc và ngữ nghĩa của một truyện tranh phân tích theo quan điểm chức năng

Ngày tải lên : 02/03/2015, 14:30

... of the text are personal (animals live and act like human beings) They are the pirate Modi, his mother, his father, the doctor and the crab wizard The finite elements in the narrative portion are ... House Halliday, M .A. K (1992) Functional Grammar London: Edward Amold Halliday, M .A. K (1994) An Introduction to Functional Grammar Second Edition London: Edward Amold Halliday, M .A. K and R Hasan (1997) ... coincides with the initial element(s) of the clause; and the Rheme is the remainder of the message The Theme may be a nominal group, an adverbial group, or a prepositional phrase The Theme may be single...

44
718
1

Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"

Ngày tải lên : 26/10/2012, 09:57

... cortex and pyramidal tract to the ventral brain stem The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subthalamic areas, in addition to the dorsal brain stem Moreover, the ... assuming the participant did not fully understand the question Statistical analysis The data was analyzed using both parametric and non parametric statistics and the specific test used was indicated ... pathways, the “voluntary path” and the “involuntary path” otherwise known as the “emotionally-driven path” (5) The voluntary pathway begins from the premotor opercular areas and travels via the motor...

12
757
0

the meaning and structure of a narrative a systemic functional analysis

Ngày tải lên : 07/09/2013, 13:48

... for the syntactic structure of language, it prefers placing the function of language as central (what language does and how language does it) rather than placing the elements of language and their ... further analyzed into Subject and Finite In the textual metafunction, a clause is analyzed into Theme and Rheme 2.4.1 The Ideational Metafunction The ideational metafunction is the means of representing ... Re-examine some of the most important issues related to the experiential aspect of functional grammar Analyze the meaning and structure of a narrative based on the systemic functional analysis...

39
826
2

The impact of technology on team functioning within a given organization

Ngày tải lên : 21/12/2013, 00:26

... Faster, Available from: http://www.lifehack.org/articles/lifehack/advantages-of -a- smaller-team.html [ accessed 22 May 2008 ] In addition, about administration side, team work allow manager can ... is also used in team management of Texas Instrument Basically, rely on characteristic of this approach, there is no one best way to manage and the management style appropriate both to the tasks ... One area where the ICT has also a significant impact is in the labor and work environment The development of ICT has contributed a great deal to many aspects of the concept of decent work The latter...

9
3.2K
2

How to get out of the friendzone: turn your friendship into a relationship

Ngày tải lên : 10/02/2014, 18:17

... other, Sam ran into Katie, who threw her arms around him and whispered that they needed to talk; she’d heard he was dating someone and wanted to know all about it After hearing about Cara, Katie ... THE SOMETIMES WE HOOK UP A friendship with occasional physical intimacy Jackson and Ali both work at a trendy fusion restaurant They don’t see each other at the restaurant that much because they ... met Cara at his coed dodgeball tournament She was pretty and nice and seemed to like him back They started dating and things were going well At a party soon after Sam and Cara started seeing each...

240
1.1K
1

Tài liệu Báo cáo " The meaning and structure of a science fiction story: a sysyemic functional analysis " doc

Ngày tải lên : 12/02/2014, 20:20

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative Modality ability/neg ability/pos ability/neg ability/neg ability/neg ... relational was III Senser mental see Existent relational were Actor material descended Actor material landed Actor material put on Goal Actor material opened Goal Actor material climbed 10 Actor material...

18
712
4

Breaking into the Game Industry: Advice for a Successful Career from Those Who Have Done It

Ngày tải lên : 13/02/2014, 17:23

... Publisher and General Manager, Course Technology PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions ... That said, a great many coders work in the casual and social space using only ActionScript (Flash) or Java/JavaScript In recent years, individuals proficient in these languages have been more and ... to a great many platforms that are ever-evolving Your ability to understand the foundational languages, C and C++, makes you infinitely more marketable and adaptable across a wide range of platforms...

304
1.7K
0

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Ngày tải lên : 19/02/2014, 16:20

... such that either the HA or the HIS epitope tag was added to the end of the ESSS ORF The forward primer was: 5¢-ACga atccGATCTCCGACCCA-3¢; the reverse primer was: 5¢-ATgctagcCTCATCTTCTGGTAACTGG-3¢ ... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... with available antisera [anti-51 kDa, anti-TYKY, anti-30 kDa, anti-18 kDa (NDUFB6)] failed to reveal the presence of any complex I-speciﬁc subunits at that position We believe that the band may...

9
622
0

Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx

Ngày tải lên : 19/02/2014, 16:20

... pGL3b:Prm3ac & pGL3e:Prm3ac (Primer Kin188; 5¢-dGAGAGGTACCGAATTAATCACAAGCAA ATCTTCTC-3¢, corresponding to NTs )119 to )94) (7) Prm3aab; pGL3b:Prm3aab & pGL3e:Prm3aab (Primer Kin160; 5¢-dGAGAGGTACCGCAAATCTTCTCTCGCC ... (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC-3¢; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and pGL3e:Prm3aOCT)1*, OCT)1 * pGL3e:Prm3ab Mutation of the ... generating pGL3b:Prm3AP)1*, pGL3e: Prm3AP)1*, pGL3b: Prm3aAP)1*, pGL3e:Prm3aAP)1*, pGL3b:Prm3abAP)1*, pGL3e: Prm3abAP)1*, pGL3b: Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1*...

18
509
0

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Ngày tải lên : 06/03/2014, 09:22

... that factor Xa cleaved and activated proHP8Xa When activated HP8Xa was mixed with proSpatzle¨ 1A, the 38 kDa pro-Spatzle band disappeared, and a ¨ 12 kDa product was produced (Fig 7A) N-terminal ... analysis using antiserum against M sexta HP8 Bands representing the proHP8Xa zymogen, a truncated form of proHP8Xa and the catalytic domain of active HP8 are marked with arrowheads The size and ... exchange chromatography SDS ⁄ PAGE analysis in the presence of b-mercaptoethanol indicated that the puriﬁed Spatzle had an ¨ apparent molecular mass of 38 kDa, which is slightly larger than that...

15
540
0

Understanding the participatory news consumer - How internet and cell phone users have turned news into a social experience pdf

Ngày tải lên : 06/03/2014, 21:20

... specifically about their news habits on a typical day,” the results are striking: 99% of American adults say that on a typical day, they get news from at least one of these media platforms: a local ... news: These are some of the demographic groups that are particularly likely to watch national broadcast and cable TV news on a typical day when compared with other adults: African-Americans, those ... home or in the car 50% say they read news in a local newspaper 17% say they read news in a national newspaper such as the New York Times or USA Today Americans today routinely get their news...

51
485
0

Báo cáo khoa học: Investigations into the ability of an oblique a-helical template to provide the basis for design of an antimicrobial anionic amphiphilic peptide pot

Ngày tải lên : 07/03/2014, 12:20

... multicellular organisms Nature 415, 389395 43 Sospedra P, Espina M, Gomara MJ, Alsina MA, Haro I & Mestres C (2001) Study at the air water interface of a hepatitis A N-acetylated and C-amidated synthetic ... assay showed that AP1 was bactericidal at mm (Fig 6) In combination, these data clearly show that the peptide is able to function as an anionic a- AMP Moreover, these results suggest that interaction ... Moffat, National Research Council, Ottawa, Ontario, Canada The band shapes of the single components are superpositions of Gaussian and Lorentzian band shapes Best ts were obtained by assuming a...

12
688
0

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Ngày tải lên : 07/03/2014, 12:20

... Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox ... acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower ... Van Montagu M, Zabeau M & Boerjan W (2001) Partial puriﬁcation and identiﬁcation of GDP-mannose 3¢,5¢-epimerase of Arabidopsis thaliana, a key enzyme of the plant vitamin C pathway Proc Natl Acad...

11
571
0

Báo cáo khoa học: Structural and functional evidence for a singular repertoire of BMP receptor signal transducing proteins in the lophotrochozoan Crassostrea gigas suggests a shared ancestral BMP/activin pathway docx

Ngày tải lên : 07/03/2014, 21:20

... embryonic and larval development (blastula, gastrula, trochophore larvae, D larvae, and 14 days post fertilization larvae, pediveliger larvae and metamorphosing larvae) were used as samples Although ... of the PAUP package The percentage recovery of the branch in 1000 bootstrap replications is indicated STPK Ancylostoma caninum (AAL06642), TGFR Brugia pahangi (ACC47801), C32D5.2(Actr) Caenohabditis ... melanogaster (AAF60175), ALK-1 Ephydatia fluvatilis (BAA82601), ALK-2 E fluvatilis (BAA82602), ALK-4 E fluvatilis (AB026827), ALK-6 E fluvatilis (AB026829), TbR-II Gallus gallus (I50429), HrBMPR Halocynthia...

17
508
0

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Ngày tải lên : 08/03/2014, 10:20

... several studies Mansouri and Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was ... oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain of the tetramer does not exhibit any proton-catalyzed auto-oxidation [22] These ... a water molecule which can then accelerate the displacement of the protonated superoxide anion, as was suggested by Tsuruga and Shikama [21] to explain the increase in oxidation rate of the a...

6
748
0

Báo cáo khóa học: Structural characterization of the human Nogo-A functional domains Solution structure of Nogo-40, a Nogo-66 receptor antagonist enhancing injured spinal cord regeneration ppt

Ngày tải lên : 16/03/2014, 16:20

... Fig 1) was generated by PCR with a pair of primers: 5¢-CG CGCGCGCGGATCCACTGGTACAAAGATTGCT-3¢ (forward) and 5¢-CGCGCGCGCCTCGAGCTAAAAT AAGTCAACTGGTTC-3¢ (reverse) A DNA fragment encoding human Nogo-66 ... was obtained from the Kazusa DNA Research Institute (KazusaKamatari, Kisarazu, Chiba, Japan) A DNA fragment encoding a 182 residue Nogo -A fragment from residues 567–748 (designated as Nogo -A( 567–748); ... NMR characterization of the Nogo -A functional domains (Eur J Biochem 271) 3513 Fig Schematic representation of the domain organization of the human Nogo -A protein (A) The domain organization...

11
493
0

Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx

Ngày tải lên : 16/03/2014, 18:20

... USA 92, 1287– 1291 Gaxiola RA, Rao R, Sherman A, Grisaﬁ P, Alper SL & Fink GR (1999) The Arabidopsis thaliana proton transporters, AtNhx1 and Avp1, can function in cation detoxiﬁcation in yeast ... view of the meh1D and vma1D cells imaged in (A) mutant strains that are defective in the vacuolar (H+) ATPase (V-ATPase) that pumps protons into the lumen ([17] and Fig 5) We qualitatively measured ... to the vacuolar membrane through a myristate tail and probably functions on the cytosolic face of the vacuole Meh1 recruits the small GTPase Gtr1 to the vacuolar membrane Proteomic analyses (http://bind.ca/);...

15
378
0

Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot

Ngày tải lên : 16/03/2014, 23:20

... mediated by the forward primer xb101+ (5¢-gccgcccatatgcaccaccaccaccaccacagcaccagtca gaactct), the reverse primer xa100– (5¢-gtggtgaattcagc cagtgtgcccttg), and pNIall2 as a template To facilitate ... NI850 (XDHABC) Property XDHAB XDHAB XDHABC XDHABC C acidovorans preparation [22] Low aeration Speciﬁc activity, UÆmg)1 Functionality, % A2 80 : A4 50 ratio FAD:aba Fe:aba Mo:aba kcat, s) 1a Km xanthine, ... of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of the xdhAB gene operon on an isolated Comamonas...

11
584
0