... with an initial solution and improve upon it after each iteration, obtaining a reasonably good approximation of the solution after a number of iterations For dense matrices, both direct and iterative ... Instruction-Level Parallel (Fined-Grained Control Parallelism) • Process-Level Parallel (Coarse-Grained Control Parallelism) • Data Parallel (Data Parallelism) These categories are not exclusive of each ... methods causing problems for storage and computation As a result, iterative solvers are more common place for sparse linear systems Iterative methods are also easier for fine-grained parallelization...
... could initially demand a username and password before they can be used! Authenticating with JAAS We have encountered a small part of the Java Authentication and Authorization Services ( JAAS) in ... demonstrate SSO authentication using JAAS, and we also used the GSS-API to authenticate a user on another system The GSS-API is a standard for authenticating users in enterprise applications ... password; } public void handle(Callback[] callbacks) { for (int i = 0; i < callbacks.length; i++) { Callback callback = callbacks[i]; if (callback instanceof NameCallback) { ((NameCallback) callback).setName(principal);...
... Application class Table 6-5 Subclasses of the Application Class Class Description ApplicationCollection A collection of all Enterprise Application Definitions ApplicationInfo Asingle application ... objCollection As New Application.ApplicationCollection Dim objApp As Application.ApplicationInfo For Each objApp In objCollection 'List only the individual applications, not group apps If objApp.Type ... Part can redeem a ticket for credentials and access credential information Administer The Web Part has full access to SSO for credential information and application administration Whether you...
... Section 4) International Alert Review of progress and summary of section Understand & Analyse Analyse stakeholders Analyse context Analyse risks and impacts Gather information on stakeholders and ... are always considered, and anti-corruption and antibribery is practised Financial responsibility: Accountability and transparency of financial dealings including auditing and reporting accurately ... government for proposals for the national budgets for 2007 and 2008 Website - www.bpa-srilanka.com An Example from Galle Town, 2006 On the day before an international cricket match was to be played...
... initial concentration of MABA-CDP bound to the enzyme, A is its total concentration, and P is the total concentration of human UCK Data were analyzed using kaleidagraph (Abelbeck Software, ALSYD, ... part of a multi-organism call for proposals We also thank the Agence Nationale de Recherches (France) for grant ANR-05-BLAN-0368 (L A Agrofoglio and D Deville-Bonne), and the Agence Nationale de ... phosphorylation of antiviral nucleoside phosphonates, catalyzed by NMP kinases, is probably a bottleneck in their activation We have looked UMP-CMP kinase and acyclic phosphonate analogs for new acyclic...
... is that because constraints on pronominal anaphora are stated entirely in terms of configurational relations of tree geometry, specifically, in terms of c-command and minimal dominating S and ... ESG and GSG (The adaptation to German was done by Ulrike Schwall.) Filler rules are stated (normally) without reference to conditions on order among constituents But there are separately stated ... original phrase structure for the whole tree is first grounded (variables are bound to unique constants) before the unit clauses are created As an example for this clausal representation, the clause...
... Cloud-based identity and access management with single sign- on (SSO) and active directory integration Okta Okta,Inc Thương mại On- demand identity and access management service in the cloud OpenAM ForgeRock ... Directory Federation Services Microsoft Claims-based system and application federation Commercial Athens access and identity management Eduserv UK Thương mại CAS / Central Authenticatio Jasig n Service ... tả sign- onSingle sign- on Numina Application Framework OneLogin Numina Solutions OneLogin Inc Thương mại Yes Thương mại Yes Miễn Phí system for Windows (OpenID RP & OP, SAML IdP, and proprietary)...
... Clinical evaluation add -on: gait, walking and orthopaedic aids, pain and additional medication for operated joint Complications: systemic and local postoperative complications and their consequences ... information consolidation, manuscript composition CT - clinical dissertation candidate Data collection and documentation, patient assessment, assistance in manuscript composition EA - statistician, ... complete data management and analysis MP senior foot and ankle specialist surgeon, main contribution for questionnaire content MD - consulting surgeon, conceptual assistance in clinical questions and...
... 5'-AGGGAACCCACAGTCACAAG-3' (position 4829–4848)/5'-GCCATCCCTCCTATCCTACC-3' (position 4987–4968) and 5'CTTGAGGCTCCCACAGATACAAT-3' (position 9367– 9389)/5'- GTTCGTAAACAGTCCCTAGTCC -3' (position 66–45) ... transposed onto a linear scale Calculations were conducted using the GrapPad software (V 4.0; GraphPad Software, Inc., San Diego, CA) Quantitative real-time PCR assays To quantitate total and circular ... model may find an application in preliminarily testing the general validity of an approach to vaccination [6], or to test the feasibility of lentiviral eradication strategies A major limitation of...
... definition and applicability) A quality indicator was defined as a measurable quantity of the TGC process that may, alone or in combination with other quantities, indicate some aspect of its quality ... useful as a proxy for reducing time in a hyperglycaemic state The hyperglycaemia index – calculated as the area between the curve and the hyperglycaemia Available online http://ccforum.com/content/12/6/R139 ... hypoglycaemia or hyperglycaemia severely hamper comparability among studies A main problem is the absence of a 'gold standard' against which to compare indicators Although there are almost no...
... intervention over time, two factorial analyses of variance (ANOVAs) with repeated measures design were calculated A series of additional analyses of covariance (ANCOVAs) were conducted entering age, ... development-specific approach for dealing with traumatic symptoms in an early stage after an RTA Young children can profit from a single- session early intervention around 10 days after an RTA We suggest ... American Psychiatric Association: The diagnostic and statistical manual of mental disorders Text revision Washington, DC: American Psychiatric Association, 1994 29 Nader KO, Kriegler JA, Blake DD, Pynoos...
... Access Manager, Sun Java System Fedearation Manager và Sun System SAML v2 Java Plugin Java Open SingleSignOn ( JOSSO) Central Authenticate Service (CAS) hoạt đông dư a Ticket 1.2.2 Đặc điểm ... SAML i có ch a SourceIDS (c) S: Tạo searchpart SAML SAM LSP (d)S →bs cid B : 302 Location D ? SAM Lsp Trong bước (b), site nguồn nhận URL ... source singlesignon authentication tool sau sử dụng: • CAS(Central Authentication Service ): Yale, Berkerley, Princeton University • Stanford WebAuth: Stanford , Oxford University • Cosign:...
... vị CAS ch a khối Ticket validation thành công: username PGTIOU-84678- 8a9 d ... Ticket validation thành công: username PGTIOU-84678- 8a9 d ... OP, SAML IdP, and proprietary) Yes Cloud-based identity and access management with single signon (SSO) and active directory integration Thương mại OneLogin OneLogin Inc Thương mại Miễn Phí Okta...
... which enabled deeper manipulation of Java classes by swapping classes during Java‘s serialization streaming for both collaboration-transparency and collaboration-aware applications It is based on ... performance of hard disks Cache File State Ready for Reading Ready for Writing Locked Action for Action for Injected Add -on Manager IDE Add -on Manager Wait until reading done Read GUI information ... interface, and (ii) to generate an add -on DLL from an add -on library project This add -on can then be loaded onto an existing application at runtime Integration of an add -on to a third-party application...
... lần (single sign on) thử nghiệm d a thư viện phpCAS NHIỆM VỤ ĐỀ TÀI Nội dung yêu cầu cần giải nhiệm vụ đề tài tốt nghiệp a Nội dung - Tìm hiểu đăng nhập lần (Single Sign On) - Tìm hiểu CAS (Central ... sĩ Cơ quan công tác: Trường Đại Học Dân Lập Hải Phòng Nội dung hướng dẫn: - Tìm hiểu SingleSignOn d a Central Authentication Service - Thử nghiệm với website PHP sử dụng thư viện phpCAS Ngƣời ... Lý thuyết Nắm sở lý thuyết đăng nhập lần (Single Sign On) Nắm trình cài đặt CAS thức triển khai SingleSignOn - Thực nghiệm (chương trình) Cài đặt CAS thực nghiệm với website PHP Các số liệu...
... Cloud-based identity and access management with single sign- on (SSO) and active directory integration Okta Okta,Inc Thương mại On- demand identity and access management service in the cloud OpenAM ForgeRock ... Directory Federation Services Microsoft Claims-based system and application federation Commercial Athens access and identity management Eduserv UK Thương mại CAS / Central Authenticatio Jasig n Service ... tả sign- onSingle sign- on Numina Application Framework OneLogin Numina Solutions OneLogin Inc Thương mại Yes Thương mại Yes Miễn Phí system for Windows (OpenID RP & OP, SAML IdP, and proprietary)...
... Succcess Factors and the straategic level this thesis appproaches Evaluating an orrganization’s strengths and weakneesses Orgaanizational strengths are a skills, caapabilities aand core ... normal economic performance whereas threats are events or phenomena in an organization s environment that make it difficult for an organization to create or maintain above ... clear that the availability of agricultural spare parts as an important issue for farmers that have an impact on their buying behavior. If the farmer buys 41 on quality and wants an original part, the farmer is more likely to go to another dealer if the ...
... PAT-Tree-Based Adaptive Keyphrase Extraction for Intelligent Chinese Information Retrieval Special issue on “Information Retrieval with Asian Language” Information Processing and Management, 1998 ... Large-scale automatic extraction of an English-Chinese translation lexicon Machine Translation, 9:3-4, 285-313 (1995) Church, K.W.(1993), Char-align A program for aligning parallel texts at the character ... 31st Annual Conference of the Association for Computational Linguistics, 1-8, Columbus, OH Dagan, I., K.W Church, and W .A Gale (1993) Robust bilingual word alignment for machine aided translation...