proteins heme oxygenase 1 and oxidative stress
Báo cáo y học: " Heme oxygenase-1 and carbon monoxide in pulmonary medicine" potx
... http://respiratory-research.com/content/4 /1/ 7 90 91 92 93 94 95 96 97 98 99 10 0 10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 11 0 11 1 Koyama H and Geddes DM: Genes, oxidative stress, and the risk of COPD Thorax 19 98, 53:S10-S14 Lomas DA and ... http://respiratory-research.com/content/4 /1/ 7 13 3 13 4 13 5 13 6 13 7 13 8 13 9 14 0 14 1 14 2 14 3 14 4 14 5 14 6 apoptosis and improved in vivo function after transplantation Diabetes 20 01, 50 :19 83 -19 91 Tobiasch E, Gunther L and Bach FH: Heme oxygenase- 1 ... J and Horowitz S: The effects of hyperoxia, mechanical ventilation, Page 12 of 13 (page number not for citation purposes) Respiratory Research 2003, 11 2 11 3 11 4 11 5 11 6 11 7 11 8 11 9 12 0 12 1 12 2...
- 13
- 670
- 0
Báo cáo khoa học: Insulin induces heme oxygenase-1 through the phosphatidylinositol 3-kinase/Akt pathway and the Nrf2 transcription factor in renal cells pptx
... including kidney [10 ], liver [11 ], heart [12 ] and small bowel [13 ], by virtue of the products of the reaction it catalyzes [14 ] Bilirubin is known to be a powerful antioxidant [15 ,16 ], and HO-derived ... management and long-term significance J Urol 15 5, 18 31 18 40 Tenhunen R, Marver HS & Schmid R (19 68) The enzymatic conversion of heme to bilirubin by microsomal heme oxygenase Proc Natl Acad Sci USA 61, ... (19 86) Characterization of two constitutive forms of rat liver microsomal heme oxygenase Only one molecular species of the enzyme is inducible J Biol Chem 2 61, 411 – 419 Maines MD (19 88) Heme oxygenase: ...
- 12
- 377
- 0
Báo cáo khoa học: Expression of heme oxygenase-1 is repressed by interferon-c and induced by hypoxia in human retinal pigment epithelial cells pot
... HO -1 mRNA, D407 and ARPE -19 cells were cultivated in fresh medium for 24 h and then exposed to the following three cytokines: interferon-c (10 0 UÆmL )1) , TNF-a (20 ngÆmL )1) and IL-1b (10 ngÆmL )1) , ... Kimura, D., Fujita, H & Shibahara, S (19 97) Possible implications of the induction of human heme oxygenase- 1 by nitric oxide donors J Biochem (Tokyo) 12 1, 11 62 11 68 14 Hara, E., Takahashi, K., Takeda, ... induced by exposure to arsenite and cadmium ions is heme oxygenase FEBS Lett 245, 17 3 17 6 10 Keyse, S.M & Tyrrell, R.M (19 89) Heme oxygenase is the major 32-kDa stress protein induced in human...
- 9
- 420
- 0
Báo cáo khoa học: The silencing of adenine nucleotide translocase isoform 1 induces oxidative stress and programmed cell death in ADF human glioblastoma cells doc
... siRNA- and Scramble-transfected cells, 72 h after transfection (Fig 6E) 10 1 FL2-H 10 2 10 3 10 1 LQ: 3% 10 0 10 1 FL2-H 10 2 10 3 UQ: 97% LQ: 97% 10 0 10 2 10 3 FL1-H 10 4 10 1 D 10 0 Fig Analysis of ANT1-silencing ... show oxidative damage as a consequence of ANT1-silencing According to this hypothesis, we found that ANT1 siRNA-treated cells 10 2 FL1-H 10 3 10 4 10 3 10 4 UQ: 86% 10 3 10 4 LQ: 14 % 10 0 10 1 10 2 FL1-H ... significantly higher in ANT1 siRNA-transfected cells FEBS Journal 277 (2 010 ) 2853–2867 ª 2 010 The Authors Journal compilation ª 2 010 FEBS B 10 4 10 0 10 0 10 1 10 2 FL1-H ANT1-silencing induces oxidative damage...
- 15
- 378
- 0
Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx
... (0 .15 –0.64) 0.83 (0.37 1. 48) P < 0.00 01 AOPP (µmol/l of chloramine-T equivalents) 75.5 ( 21 91) 10 9 .1 (50–2 81) P < 0.00 01 VEGF (pg/ml) 2 21 (19 –499) 573.5 (26 19 15) P = 0.00 01 sVEGFR -1 (pg/ml) 19 ... different before and after nifedipine treatment (11 00 ± 11 90 vs 14 50 ± 12 80; P = 0.4) Discussion We found that 14 days of treatment with nifedipine decreased serum vascular and oxidative damage ... conditions and stimulation by transforming growth factor, CD40 ligand, interleukin 1, or interleukin [10 ] Oxidative stress also promotes angiogenesis [13 ] The link between oxidative stress and angiogenesis...
- 6
- 518
- 0
Báo cáo y học: " Impaired glucose transporter-1 degradation and increased glucose transport and oxidative stress in response to high glucose in chondrocytes from osteoarthritic versus normal human cartilag" pps
... accession number Glucose transporter -1 Forward: CGTCTTCATCATCTTCACTG 14 8 [Genbank:NM_006 516 ] β-Actin Forward: AACTACCTTCAACTCCAT 16 1 [Genbank:NM_0 011 01] 15 5 [Genbank:NM_0 211 30] Reverse: CTCCTCGGGTGTCTTATC ... 11 :2367-23 81 11 Maroudas A: Distribution and diffusion of solutes in articular cartilage Biophys J 19 70, 10 :365-379 12 Brannan SR, Jerrard DA: Synovial fluid analysis J Emerg Med 2006, 30:3 31- 339 ... Arthritis Res Ther 2008, 10 :R46 17 Rolo AP, Palmeira CM: Diabetes and mitochondrial function: role of hyperglycemia and oxidative stress Toxicol Appl Pharmacol 2006, 212 :16 7 -17 8 18 Tiku ML, Shah R,...
- 11
- 431
- 0
Báo cáo y học: "Differential expression of copper-associated and oxidative stress related proteins in a new variant of copper toxicosis in Doberman pinscher" potx
... TGT ATG 58 10 0 AB038240 56 10 0 64 99 L77488 / L77489 AF346 417 62 11 9 AB 012 918 62 13 1 AY572226 62 12 3 AY572225 64 96 AY572228 60 90 AY455798 61 87 AB 116 145 67 13 7 AF179 715 60 12 7 AY6030 41 50 99 AY603040 ... Hepatol 19 96, 24 :10 9 -12 0 Sternlieb I: Copper and the liver Gastroenterology 19 80, 78 :16 15 -16 28 Thornburg LP: A perspective on copper and liver disease in the dog J Vet Diagn Invest 2000, 12 :10 1 -11 0 ... CCS SOD1 CAT GSS 1, 50 1, 00 0,50 0,00 Control C DH 3,00 mRNA levels (fold change) GPX1 (p
- 13
- 300
- 0
Báo cáo y học: "NITRIC OXIDE (NO), CITRULLINE – NO CYCLE ENZYMES, GLUTAMINE SYNTHETASE AND OXIDATIVE STRESS IN ANOXIA (HYPOBARIC HYPOXIA) AND REPERFUSION IN RAT BRAIN"
... no conflict of interest exists References 10 11 12 13 14 15 Coyle JT, Puttfarcken P Oxidative stress, glutamate and neurodegenerative disorders Science 19 93; 262: 689-695 Platt SR The role of glutamate ... Neurosci 19 94; 17 : 359-365 Van der berg CJ, Garfinkel D A stimulation study of brain compartments, metabolism of glutamate and related substances in mouse brain Biochem J 19 71; 12 3: 211 - 218 Berman ... group; a p < 0.0 01, a1 p
- 8
- 622
- 0
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... down-regulates heme oxygenase- 1 no apparent correlation between the expression levels of HO -1 and HO-2 and cellular heme content The cellular heme content represents the sum of free heme and bound heme ... human heme oxygenase- 1 by nitric oxide donors J Biochem (Tokyo) 12 1, 11 62 11 68 38 Hara E, Takahashi K, Takeda K, Nakayama M, Yoshizawa M, Fujita H, Shirato K & Shibahara S (19 99) Induction of heme ... 2006 FEBS 5345 Heme oxygenase- 2 down-regulates heme oxygenase- 1 49 50 51 52 Y Ding et al factor, regulates induction of the heme oxygenase- 1 gene J Biol Chem 274, 260 71 26078 Sun J, Brand M, Zenke...
- 14
- 487
- 0
Báo cáo khoa học: Calcium, mitochondria and oxidative stress in neuronal pathology Novel aspects of an enduring theme pdf
... Chinopoulos and V Adam-Vizi 10 3 10 4 10 5 10 6 10 7 10 8 10 9 11 0 11 1 11 2 11 3 11 4 tion, release of cytochrome c and cell death Correlation with the duration of pore openings in situ J Biol Chem 276, 12 030 12 034 ... Biophys Acta 12 41, 13 9 17 6 Bernardi P (19 99) Mitochondrial transport of cations: channels, exchangers, and permeability transition Physiol Rev 79, 11 27 11 55 Duchen MR (2000) Mitochondria and Ca2+ ... [14 5 ,14 9 ,15 0 ,15 5] Results supporting views that DCD is comprised of an active Ca2+ influx pathway [93 ,14 6 ,14 9 ,15 0 ,15 5 15 9] as well as those indicating a failure in Ca2+ efflux mechanisms [16 0 16 2],...
- 18
- 549
- 0
Báo cáo khoa học: Cotton GhMPK2 is involved in multiple signaling pathways and mediates defense responses to pathogen infection and oxidative stress doc
... pathways in response to both pathogen infection and oxidative stress FEBS Journal 278 (2 011 ) 13 67 13 78 ª 2 011 The Authors Journal compilation ª 2 011 FEBS L Zhang et al Cotton GhMPK2 is involved ... FEBS Journal 278 (2 011 ) 13 67 13 78 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 13 71 Cotton GhMPK2 is involved in multiple signaling pathways L Zhang et al Oxidative stress tolerance in transgenic ... instructions, and was separated on a 1% agarose– formaldehyde gel RNA was transferred onto Hybond-N+ FEBS Journal 278 (2 011 ) 13 67 13 78 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 13 75 Cotton...
- 12
- 348
- 0
Báo cáo khoa học: Heme oxygenase-1 ⁄p21WAF1 mediates peroxisome proliferator-activated receptor-c signaling inhibition of proliferation of rat pulmonary artery smooth muscle cells pot
... and FEBS Journal 277 (2 010 ) 15 43 15 50 ª 2 010 The Authors Journal compilation ª 2 010 FEBS M Li et al 10 11 12 13 14 murine SMCs and its role in pulmonary hypertension J Clin Invest 11 8, 18 46 18 57 ... p21WAF1 As shown in Fig 4A, transfection of p21WAF1 siRNA for 72 h produced an 82% reduction in p21WAF1 protein FEBS Journal 277 (2 010 ) 15 43 15 50 ª 2 010 The Authors Journal compilation ª 2 010 ... Biochem Cell Biol 38, 16 37 16 41 29 Besson A, Dowdy SF & Roberts JM (2008) CDK inhibitors: cell cycle regulators and beyond Dev Cell 14 , 15 9 16 9 FEBS Journal 277 (2 010 ) 15 43 15 50 ª 2 010 The Authors Journal...
- 8
- 333
- 0
Báo cáo khoa học: The crystal structure of annexin Gh1 from Gossypium hirsutum reveals an unusual S3 cluster Implications for cellulose synthase complex formation and oxidative stress response potx
... Glu 113 -Arg2 71 CO 117 -Arg276 Asp39-Arg 118 Arg276-Asp280 – Glu 116 -Arg272 CO120-Arg277 Asp96-Arg1 21 Arg277–2 81 – Glu 112 -Arg2 71 – Asp92-Arg 117 Arg276-Asp280 groove on the convex side (cf Figure 1B) ... Hofmann et al (Eur J Biochem 270) 12 13 14 15 16 17 18 19 20 21 22 23 24 25 subunits occurs via oxidation of the zinc-binding domains Proc Natl Acad Sci USA 99, 11 109 11 114 Boustead, C., Smallwood, ... Anx(Gh1) Anx24(Ca32) IAB IDE IIAB IIAB IIDE IIDE IIIAB IIIAB IIIDE IVAB IVAB Trp32 Lys72 Arg103 Trp104 His144 His145 Lys187 Tyr189 Lys230 Arg2 61 Arg262 Trp35 Lys 71 Arg106 Trp107 Tyr147 His148 Lys190...
- 8
- 475
- 0
Báo cáo khoa học: The molecular chaperone a-crystallin incorporated into red cell ghosts protects membrane Na/K-ATPase against glycation and oxidative stress ppt
... b- and c-crystallins J Biol Chem 270, 19 888 19 892 15 Wang, K & Spector, A (19 95) a-Crystallin can act as a chaperone under conditions of oxidative stress Invest Ophthalmol Vis Sci 36, 311 –3 21 16 ... Effects of 0 .1, and 10 mM methylglyoxal and 0 .1 mM ouabain on the 86Rb uptake into red cell ghosts after h incubation at 37 °C, and the effect of the molecular chaperone a-crystallin (1 mgÆmL -1) resealed ... renal medulla in diabetes Biochem Biophys Res Commun 13 1, 12 06 12 11 Haik, G.M., Jr., Lo, T.W.C & Thornalley P.J (19 94) Methylglyoxal concentration and glyoxalase activities in the human lens Exp Eye...
- 7
- 291
- 0
Báo cáo khoa học: Crystal structure of heme oxygenase-1 from cyanobacterium Synechocystis sp. PCC 6803 in complex with heme pot
... Syn HO -1 Gly130, Gly134, Gly135, and Asp1 31 correspond to Gly139, Gly143, Gly144, and Asp140 in human and rat HO-1s and to Gly135, Gly139, Gly140, and Asp136 in HmuO F-helix confomation Gly130 O–Fe ... O–Fe Gly134 N–Fe Gly130 O–Gly134 N Gly130 O–Gly135 N Asp1 31 O–Gly135 N Syn HO -1 Human HO -1 Human HO -1 Rat HO -1 HmuO closed closed open more closed closed 4.6–4.9 4.8 4.9 5 .1 4.7–4.8 5 .1 5.4 5.3 ... 0.35 A The folding of heme Syn HO -1 is similar to the folding observed in other heme HOs [rmsd of Cas are 0.94– ˚ ˚ 1. 06 A for human HO -1, 1. 06 1. 16 A for rat HO -1, ˚ 1. 17 1. 40 A for HO from the...
- 9
- 358
- 0
báo cáo hóa học: " Brain inflammation and oxidative stress in a transgenic mouse model of Alzheimer-like brain amyloidosis" pptx
... Neuroinflammation 2004, 1: 21 http://www.jneuroinflammation.com/content /1/ 1/ 21 150 10 0 * 50 * A 1- 40 (percentage) A 1- 40 (percentage) 15 0 * 50 Cortex Hippocampus Cortex * Hippocampus 15 0 10 0 * 50 * A 1- 42 (percentage) ... anti-inflammatory drugs 10 PGE2: Prostaglandin E2 11 TxB2: Thromboxane A2 12 13 GFAP: Glial fibrillary acidic protein IL -1 : Interleukin 1- β 14 IPF2α-VI: Isoprostane F2α-VI Competing interests 15 The authors ... Brain A 1- 40 and A 1- 42 levels Sequential extraction of brain samples was performed with high-salt buffer and formic acid, respectively to measure soluble and insoluble A 1- 40 and A 1- 42 levels,...
- 9
- 490
- 0
Báo cáo y học: "Association of reduced heme oxygenase-1 with excessive Toll-like receptor 4 expression in peripheral blood mononuclear cells in Behçet''''s disease" potx
... Table HO -1 mRNA expression in patients with BD PBMCs/PMNs Ocular involvement HLA-B 51 - (n = 17 ) - (n = 10 ) + (n = 14 ) PBMCs 7.7 ± 3 .1 5.7 ± 4 .1 8 .1 ± 3.9 5.6 ± 3.7 PMNs HO -1 (AU) + (n = 16 ) 32.9 ... rheumatoid arthritis: com- Page of 10 (page number not for citation purposes) Arthritis Research & Therapy 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Vol 10 No Kirino et al ment on the ... 16 ) 32.9 ± 46 .1 31. 6 ± 34 .1 31. 6 ± 38.0 19 .9 ± 18 .0 Values are expressed as mean ± standard deviation AU, arbitrary unit; BD, Behçet's disease; HLA, human leukocyte antigen; HO, heme oxygenase; ...
- 10
- 355
- 0
Shorter GT repeat polymorphism in the heme oxygenase-1 gene promoter has protective effect on ischemic stroke in dyslipidemia patients potx
... http://www.jbiomedsci.com/content /17 /1/ 12 Page of o 40 35 frequency (%) 30 25 20 15 10 15 16 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 Number of (GT)n repeats 18 16 frequency (%) 14 12 10 15 16 17 18 19 ... female 2.07 (1. 07-4. 01) 0.0303 2.02 (1. 01- 4.02) 0.0465 TC < 240 mg/ dL 1. 62 (0.93-2.83) 0.0 918 1. 63 (0.88-2.39) 0 .11 82 LDL-C < 13 0 mg/ dL 1. 91 (1. 01- 3. 61) 0.0480 1. 63 (0.85-3 .13 ) 0 .14 35 Odds Ratio ... = 16 4) N (%) P Gender Male 11 4 (62.3) 87 (53 .1) 0.0 815 Diabetes Yes§ 64 (35.0) 19 (11 .6)
- 9
- 127
- 0
Heme oxygenase-1 plays a pro-life role in experimental brain stem death via nitric oxide synthase I/protein kinase G signaling at rostral ventrolateral medulla pps
... brain stem death [18 ] In addition, heme oxygenase- 1 (HO -1) [19 - 21] , and both NOS I [ 21, 22] and NOS II [20,23] are known to be hypoxia responsive gene products; upregulation of HO -1 is mediated transcriptionally ... of the concern for species difference Page 11 of 12 10 11 12 13 Conclusions We conclude that transcriptional upregulation of HO -1 on activation of HIF -1 in RVLM plays a preferential pro-life role ... read and approved the final manuscript Competing interests The authors declare that they have no competing interests 14 15 16 17 18 19 20 21 22 Received: 27 July 2 010 Accepted: September 2 010 Published:...
- 12
- 123
- 0
Báo cáo khoa hoc:" Lack of association between mutations of gene-encoding mitochondrial D310 (displacement loop) mononucleotide repeat and oxidative stress in chronic dialysis patients in Taiwan" ppsx
... = 213 P-value 48.3 ± 14 .2 71 22 .1 ± 3.4 13 4 ± 25 77 ± 14 1. 126 ± 0.628 1. 515 ± 0.457 16 64 ± 25 51 10.2 ± 1. 7 31. 1 ± 5.4 68.6 ± 18 .1 12.5 ± 2.7 13 7 ± 4.4 ± 0.8 9.3 ± 1. 0 5 .1 ± 1. 5 3.8 ± 0.4 11 3 ... 47 19 0 ± 34 16 2 ± 12 7 49.2 ± 13 .6 83 23.8 ± 3.7 13 0 ± 20 82 ± 12 0.7 71 ± 0.478 2 .11 0 ± 0.423 412 ± 270 14 .0 ± 1. 5 42.2 ± 4.0 13 .9 ± 4.2 1. 0 ± 0.2 14 1 ± 4.2 ± 0.3 9 .1 ± 0.4 3.5 ± 0.5 4.3 ± 0.3 10 1 ... 2009, 8 :10 10 11 12 13 14 15 http://www.jnrbm.com/content/8 /1/ 10 Ohkawa H, Ohishi N, Yagi K: Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction Anal Biochem 19 79, 95:3 51- 358...
- 7
- 352
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008