protein protein interaction networks a perspective toward systems biology

... fibrosis; P aeruginosa PAO1 was isolated from a wound [32] P aeruginosa is a versatile Gram-negative bacterium that also thrives in soil, marshes and coastal marine habitats, and on plant tissues ... the computational aspect Additional data files The following additional data are available with the online version of this paper Additional data file is a figure that shows the reliability of ... chemotaxis in E coli K12 and Salmonella revealed that Salmonella lacks Tap, which transports maltose, but has Tcp, which transports citrate In contrast, E coli has Tap but lacks Tcp CCC analysis alone...

Ngày tải lên: 14/08/2014, 08:20

... Kuraoka I, Morita EH, Saijo M, Matsuda T, Morikawa K, Shirakawa M & Tanaka K (1996) Identification of a damaged-DNA binding domain of the XPA protein Mutat Res 362, 87–95 Ikegami T, Kuraoka I, Saijo ... The XPA protein is a zinc metalloprotein with an ability to recognize various kinds of DNA damage Mutat Res 315, 229–237 101 Nitta M, Saijo M, Kodo N, Matsuda T, Nakatsu Y, Tamai H & Tanaka K (2000) ... xeroderma pigmentosum group A complementing protein to damaged DNA Biochemistry 32, 12096– 12104 100 Asahina H, Kuraoka I, Shirakawa M, Morita EH, Miura N, Miyamoto I, Ohtsuka E, Okada Y & Tanaka K...

Ngày tải lên: 07/03/2014, 21:20

... 2.1 Manual curation PathArt (proprietary pathway database from Jubilant Biosys Ltd.) is a manually curated database which covers more than 2800 signaling and metabolic pathways across 34 diseases ... (proprietary protein interactions maps database from Jubilant Biosys Ltd.) was used IMaps is a manually curated database with more than 200 000 protein- protein, proteinRNA, protein- small molecule, and protein- DNA ... method, and intracellular localization (cytoplasm, membrane, and nucleus) Data is manually entered into PathArt using a curator work bench, a software tool that accepts data in a defined format, and...

Ngày tải lên: 22/06/2014, 19:20

... Butland dataset Buchnera, Butland dataset (2/7) Buchnera constrained, Arifuzzaman dataset 0.179 0.413 0.332 0.081 (4/8) Buchnera, Arifuzzaman dataset 0.192 12 (6/11) E coli, Arifuzzaman dataset 0.461 ... Maeda M, Itoh A, Nishikata K, Takita C, Saito R, Ara T, Nakahigashi K, Huang HC, Hirai A, et al.: Large-scale identification of protein- protein interaction of Escherichia coli K-12 25 26 27 28 ... links attached to them This creates a network of 1,638 interaction pairs for the Butland dataset and 549 for the Arifuzzaman dataset, implying that the latter is enriched in interactions between proteins...

Ngày tải lên: 14/08/2014, 07:21

... protein- protein interactions in Saccharomyces cerevisiae Nature 2000, 403:623-627 Ito T, Tashiro K, Muta S, Ozawa R, Chiba T, Nishizawa M, Yamamoto K, Kuhara S, Sakaki Y: Toward a protein- protein interaction ... isolate its interaction partners (c) A matrix yeast two-hybrid screen used to generate a protein- protein interaction network Several baits and preys are arrayed in 96-well microtiter plates and ... as a histone acetyltransferase as well as a transcription factor Interactions of mutant Htt with CBP abrogates the acetyltransferase activity of this protein in vitro, reducing the level of acetylated...

Ngày tải lên: 14/08/2014, 14:21

... Tsunemi T, Li M, Kobayashi K, Yokota T, Amino T, Owada K, Fujigasaki H, Sakamoto M, et al.: An autosomal dominant cerebellar ataxia linked to chromosome 16q22.1 is associated with a single-nucleotide ... tractable therapeutic targets that are shared among a range of diseases - an enticing prospect A corollary to this is that certain proteins in this network may be excellent functional candidates ... prey Interaction from hORFeome Interaction from cDNA library Figure An interaction network of proteins involved in spinocerebellar ataxias The yeast two-hybrid interaction data of Lim et al [1]...

Ngày tải lên: 14/08/2014, 17:22

... interactome The saturation can be revealed by plotting, for each additional assay, the total interactions mapped versus the novel interactions mapped Early assays fall along the diagonal (all interactions ... large-scale assays sample the same portion of interaction space’ (that is, they sample the same n2 deposited research Computational and experimental approaches have now mapped a great many yeast and ... 403:623-627 Additional data files Additional data on the statistics used are available online as Additional data file References Bandyopadhyay S, Sharan R, Ideker T: Systematic identification of...

Ngày tải lên: 14/08/2014, 17:22

... folds, including all alpha, all beta, alpha and beta (a/ b), alpha and beta (a+ b), multi-domain proteins and so on SCOP 1.75 release (23 Feb 2009) was applied to our MoRF dataset on partner side to ... β-strand to form an anti-parallel β-sheet with another strand on DAB1 protein The spatial arrangement of a tyrosine was observed to change substantially, suggesting that this change may facilitate ... Eshel, Caron, Fei, Maya and Bo for always being my technical and mental support I also appreciated the chance to collaborate with other researchers outside of Indiana University I thank Dr Sarah Bondos...

Ngày tải lên: 24/08/2014, 09:56

... suggestions and feedback My thanks also to my friends at NUS, especially the ‘tea gang’: Sucheendra Palaniappan, Sudipta Chattopadhyay, Manoranjan Mohanty, Dr Dhaval Patel, Harish Katti, Ashwin Nanjappa ... [56] and the MIPS Mammalian Protein- Protein Interaction Database (MPPI) [57] is a comprehensive catalogue of yeast and mammalian protein interactions and hand-curated complexes, while the Human Protein ... several databases have been set up to catalogue, study and analyze these interactions Some publicly available databases and their Web sources are listed in Table 2.3 The Database of Interacting Proteins...

Ngày tải lên: 16/09/2015, 12:17

... network that contains 2930 binary interactions among 2018 proteins We will call these data sets as 2000 and 2008 experimental data sets It was estimated that these interactions represent only about ... Jeong, S Mason, A L Barabasi, Z N Oltvai, Nature 411 (2001) 41 [7] H Yu et al., Nature 322 (2008) 104-110 [8] R Albert, A. -L Barabasi, Rev Mod Phys 74 (2002) 47 [9] A. -L Barabasi, R Albert, Science ... XUAN HOANG Protein interaction networks are generally expressed in form of a graph in which each node denotes a protein and a connection between two nodes is present if there is a physical interaction...

Ngày tải lên: 30/10/2015, 19:39

... have also been efforts to understand protein protein interactions (Janin et al., 2003) and again to try to predict these There are specialty databases such as the Nucleic Acid Database (Berman ... relational database To accommodate data from NMR and cryoEM experiments, a PDB Exchange Dictionary (PDBx) was created that has the same syntax as mmCIF but contains all the definitions needed to handle ... (http://www.ebi.ac.uk/ msd) include analyses of macromolecule ligand interactions, statistical analyses and residue-based analyses (Golovin et al., 2004) The accessibility of the data and the growing importance...

Ngày tải lên: 16/02/2014, 11:20

... bar graph indicates that 86% of the proteins of the set is predicted to have a contact surface with an accuracy higher than random Noticeably, 66% of the proteins are predicted to have a contact ... L., Cagney, G., Mansfield, T .A. , Judson, R.S., Knight, J.R., Lockshon, D., Narayan, V., Srinivasan, M., Pochart, P et al (2000) A Comprehensive analysis of protein protein interaction in Saccharomyces ... C was also partially supported by a grant for a target project in Biotechnology of the Italian Centro Nazionale delle Ricerche (CNR) We thank the Italian ` Ministero della Universita e della Ricerca...

Ngày tải lên: 21/02/2014, 15:20

... (bold) was introduced into the forward primer (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced into the reverse primer (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) ... post-translational modification pathways, such as phosphorylation, glycosylation, myristoylation and palmitoylation present in mammalian systems are also utilized in insect cell lines, allowing ... interaction between GnRH-R molecules The effect of a GnRH agonist and antagonist on GnRHR association has also been examined The data showed that FRET was enhanced by the addition of a GnRH agonist...

Ngày tải lên: 30/03/2014, 20:20

... non-Reactome human-curated pathway databases were imported into the Reactome database (28 March 2009 release) These four databases are: Panther [27], CellMap [61], NCI Pathway Interaction Database ... Phani Garapati, Marc Gillespie, Gopal Gopinath, Jill Hemish, Henning Hermjakob, Bijay Jassal, Alex Kanapin, Suzanna Lewis, Shahana Mahajan, Lisa Matthews, Bruce May, Esther Schmidt, and Imre Vastrik ... used by pathway databases are much richer than a simple binary relationship A pathway database describes pathways in terms of proteins, small molecules and cellular compartments that are related...

Ngày tải lên: 09/08/2014, 20:22

... co-expression and GO distance, which are noisy sensors for the actual interaction variable Tij.I Note that an actual interaction variable may have several observation variables if the pair appears in ... performed an anecdotal evaluation that focuses on interactions of particular interest for human disease Many genetic diseases in human have been mapped to a single amino-acid mutation and cataloged ... S, Navarro JD, Amanchy R, Kristiansen TZ, Jonnalagadda CK, Surendranath V, Niranjan V, Muthusamy B, Gandhi TK, Gronborg M, et al.: Development of human protein reference database as an initial...

Ngày tải lên: 14/08/2014, 08:20

... 5'-(CGCGGACCGTTAACTGATATCACCATGAGACATG)-3' SMF2 Forward 5'-(CGCGGTCCGCTACGTAGCCACCATGACGTCCCAAGAATATGAACC)-3' SMF2 Reverse 5'-(CGCGGACCGTTAGAGGTGTACTTCTTTGCCCG)-3' SMP1 Forward 5'-(CTCGGTCCGCCACCATGGGTAGAAGAAAAATTGAAATTGAACC)-3' ... name Forward/reverse Primer NRG1 Forward 5'-(CTCGGTCCGCCACCATGTTTTACCCATATAACTATAGTAAC)-3' NRG1 Reverse 5'-(CTCGGACCGTTATTGTCCCTTTTTCAAATGTGTTC)-3' 5'-(CGCGGTCCGCTACGTAGCCACCATGAATCCTCAAGTCAGTAACATC)-3' ... 5'-(CGCGGTCCGCTACGTAGCCACCATGAATCCTCAAGTCAGTAACATC)-3' PHO88 Forward PHO88 Reverse 5'-(CGCGGACCGTCATTCAGCCTTAACACCAGCG)-3' SMF1 Forward 5'-(CGCGGTCCGGTTTAAACAGGCCACCATGGTGAACGTTGGTCCTTCTC)-3' SMF1 Reverse 5'-(CGCGGACCGTTAACTGATATCACCATGAGACATG)-3'...

Ngày tải lên: 14/08/2014, 08:21

... interactions are available in Additional data file available online with this article and can also be searched or downloaded from our website [12] Assessment of the accuracy of the interaction datasets ... human biology and acts as a guide for a future experimental human protein- interaction mapping project http://genomebiology.com/2004/5/9/R63 Table The number and accuracy of human protein interactions ... organism interaction datasets; and the ability to identify the human orthologs of a model organism protein Our analysis suggests that the raw yeast and worm protein- interaction datasets are currently...

Ngày tải lên: 14/08/2014, 14:21

... duplicated genes based on the protein- protein network analysis This work validates the use of interaction data and the analysis of interaction networks as a new means of investigating evolutionary ... binding, far western, gel retardation and biochemical experiments) Additional data files The following additional data are available with the online version of this paper Additional data file contains ... cerevisiae, less than 10% of the gene pairs, remnants of the WGD, are amenable to such a detailed analysis As our knowledge on interaction networks is increasing and as more interactions become available,...

Ngày tải lên: 14/08/2014, 14:21

... http://genomebiology.com/2004/5/12/R96 and are also available at [47,50] and at IntAct [51] in the Proteomics Standards Initiative - Molecular Interactions (PSIMI) standard exchange format [52] Data analysis ... data with other datasets we generated random interaction maps having the same BD proteins, total interactions and topological properties as the LexA or Gal4 data The AD clones in each interaction ... following additional data are available with the online version of this paper Additional data file contains Supplementary materials and methods; Additional data file contains Supplementary Table 1,...

Ngày tải lên: 14/08/2014, 14:21

... expression and lipid homeostasis Mol Cell Biol 21, 1393–1403 Yamamoto T, Shimano H, Nakagawa Y, Ide T, Yahagi N, Matsuzaka T, Nakakuki M, Takahashi A, Suzuki H, Sone H et al (2004) SREBP-1 interacts ... in part, a mechanism through which dietary saturated fats stimulate hyperlipidemia and atherogenesis SREBPs dock on PGC-1b at a domain that has no counterpart in PGC- 1a, and hence, PGC- 1a does ... the interaction SREBPs interact with activating transcription factor-6 (ATF6) and nuclear receptors to regulate their transcriptional activities ATF6 is an ER membrane-bound transcription factor...

Ngày tải lên: 18/02/2014, 13:20