properties of as hg sn and pb
Báo cáo hóa học: " Optical properties of as-grown and annealed InAs quantum dots on InGaAs cross-hatch patterns" doc
Ngày tải lên :
21/06/2014, 01:20
... smaller (a) GaAs cap (b) In0.13Ga0.8 7As GaAs buffer (001)-GaAs [110] [1-10] Figure Structure of InAs QDs on InGaAs CHPs (a) Schematic cross-sectional diagram of the QDs on CHP structure and (b) a ... resulting from the state filling of each of the GS emerge, as expected Sample B (CHP) is basically an InGaAs quantum well (QW) sandwiched between the GaAs buffer and GaAs capping layers The lattice-mismatched ... technique Results and discussion The optical properties of the as- grown and annealed QDs on CHP structure are analyzed against those of the controlled QDs and CHP samples The results for asgrown samples...
- 7
- 267
- 0
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
Ngày tải lên :
17/03/2014, 09:20
... concentrations (Fig 3B) of the biopterin cofactors or dopamine the rate of phosphorylation was decreased, and at 200 lM of the ligands the inhibition was more pronounced for H4biopterin ( 26%) and dopamine ... catalytic subunit of cAMP-dependent protein kinase was puried to homogeneity from bovine heart and was a generous gift from S O Dứskeland, Department of Anatomy and Cell Biology, University of Bergen ... coli) of specic labile Asn residues [10] Complementary mutagenesis (AsnAsp) analyses have demonstrated that the rate of phosphorylation is indeed dependent on the extent of deamidation of a very...
- 10
- 470
- 0
Báo cáo khoa học: Cytokine properties of prokineticins Justin Monnier and Michel Samson pptx
Ngày tải lên :
23/03/2014, 07:20
... neutrophil and monocyte count was increased, and the mouse spleen was enlarged as a result of the large number of immune cells produced (Table 1) [26] Migration In addition to their hematopoietic properties, ... increase in the number of granulocytic and monocytic colonyforming units [26] This was further observed in another study where human and mouse CD34+ cells showed a decrease in expression of CD34 and ... to be highly basic with a pI of 8.85 and a pI of 10.68, respectively Thus, prokineticin activity may Cytokine properties of prokineticins also be regulated through the binding of extracellular...
- 8
- 439
- 0
Báo cáo khoa học: "FACTORING RECURSION AND DEPENDENCIES: AN ASPECT OF TREE ADJOINING GRAMMARS (TAG) AND A COMPARISON OF SOME FORMAL PROPERTIES OF TAGS, GPSGS, PLGS, AND LPGS " pot
Ngày tải lên :
24/03/2014, 01:21
... 1,2,3,4,5, and In TABLE I give some idea of the degree of freedom The language in in TABLE I is the extreme case where the a's, b's ,and c's can he any order, as long as the number of a's =the number of ... n the base and the transformations essentially carry out the checking of the dependencies The PiG's and LFG's share this aspect 'of TG,i.e., tee.talon builds up a set of structures, some of w h ... cross-serial dependencies as well as, of course, nested dependencies ( ) The c r o s s - s e r i a l dependencies as well as the nested dependencies arise as a result of adjoining But this is...
- 9
- 354
- 0
Báo cáo khoa học: Kininogen-derived peptides for investigating the putative vasoactive properties of human cathepsins K and L docx
Ngày tải lên :
31/03/2014, 07:20
... Diverse effects of a mixture of neutrophil elastase and mast cell tryptase versus tissue and plasma kallikreins on native and oxidized kininogens J Biol Chem 273, 33224–33229 14 Sato, F & Nagasawa, S ... produces BK(5–9) from BK and Lys-BK, and suggests that cathepsin K is a new member of the kininase family Both the kininogenase activity of cathepsin L and/ or the kininase activity of cathepsin K may ... Mechanism of kinin release from human low-molecular-mass-kininogen by the synergic action of human plasma kallikrein and leukocyte elastase Biol Chem Hoppe Seyler 369, 1009–1017 15 Ishii, Y., Hashizume,...
- 8
- 482
- 0
Tensile properties of cooked meat sausages and their correlation with texture profile analysis (TPA) parameters and physico chemical characteristics
Ngày tải lên :
05/05/2014, 08:43
... times (January, May and October) maintaining brands and meat sausage type At every time of purchase, eight samples were of chopped (CH), nine of mortadella (MT), and seven of galantines (GL) Chopped ... total fat content of the samples was determined by cold extraction in chloroform and methanol in the presence of antioxidant BHT as described by Hanson and Olley (1963) and was quantified gravimetrically ... profiles and with similar (p > 0.05) values of BS and hardness to textural profile 1, and similar values (p > 0.05) of cohesiveness and springiness to profile 3, and intermediate values of adhesiveness...
- 7
- 445
- 0
Báo cáo khoa học: "Comparison of flexural and shear properties of southern pine LVL and lumber from young plantation and natural stands*" ppsx
Ngày tải lên :
08/08/2014, 18:21
... Testing and Materials (ASTM) (1991) Standard methods of static tests of timbers in standard sizes, D 198-84 Standard method of testing small clear specimens of timber D 143-83 In: American Book of ASTM ... veneers of older natural stands The average MOR and MOE values of LVL from the 20-year-old trees are only 54 and 63%, respectively, of the properties of LVL from 40-year-old trees from natural stands ... Comparison of grade, yield, and mechanical properties of lumber produced from young fast-grown and older slowgrown planted slash pine Forest Prod J 40, 11-14 Pearson RG, Gilmore RC (1980) Effect of fast...
- 9
- 253
- 0
Báo cáo khoa hoc:" Role of HOXA7 to HOXA13 and PBX1 genes in various forms of MRKH syndrome (congenital absence of uterus and vagina)" ppt
Ngày tải lên :
11/08/2014, 08:20
... amplification of genomic DNA of PBX1 gene exons Primer name Gene segment Sequence 5'-3' PBX1-1-F PBX1-1-R PBX1-2-F PBX1-2-R PBX1-3-F PBX1-3-R PBX1-4-F PBX1-4-R PBX1-5-F PBX1-5-R PBX1-6-F PBX1-6-R PBX1-7-F ... TGTTTGCTGATTGCTTCGAC PBX1 exon PBX1 exon PBX1 exon PBX1 exon PBX1 exon PBX1 exon PBX1 exon PBX1 exon is required for skeletal development and patterning [27], kidney morphogenesis [28] and especially, ... performing genetic linkage analysis of familial cases and wholegenome scan to seek for candidate chromosomal loci Authors' contributions - AB was in charge of most of the PCR and sequencing reactions http://www.jnrbm.com/content/5/1/4...
- 6
- 424
- 0
Structure, magnetic and transport properties of magnetic oxide materials and exploration of magnetic oxides semiconductor (zno) heterostructures
Ngày tải lên :
09/09/2015, 10:15
... the ~30nm CoFe2O4 films with the largest strain was blessed with large out of plane anisotropy with Hc as large as 10 KOe The growth of textured structure and the magnetic anisotropy was attributed ... Table Resistivity of the γ-Fe2O3 of the as deposited thin film and after annealing; thickness dependent saturated magnetization and coercivity of the as deposited (350˚ C, 500 ˚ C) and after annealing ... measurement was conducted both at 300K and 5K 116 XI LIST OF FIGURES Figure 1 The density of state of non-magnetic, ferromagnetic, and half metallic meterials Figure Schematic diagram of...
- 175
- 592
- 0
Electronic, magnetic and optical properties of oxide surfaces, heterostructures and interfaces role of defects
Ngày tải lên :
10/09/2015, 09:11
... like to sincerely thank my supervisors Prof Ariando and Prof T Venkatesan for educating and encouraging me Prof Ariando keeps me motivated in my research and persistently supports me without any ... who can easily connect the knowledge of different areas together as his brain is “a live library” of material science It is well his creativity and enthusiasm that enlighten me to boldly and creatively ... will ever be indebted to Prof Ariando and Prof T Venkatesan I would like to take this opportunity to thank Prof J M D Coey from Ireland, who has ever been a visiting professor in Nanocore for several...
- 307
- 988
- 0
Tài liệu Báo cáo khoa học: Enzymatic properties of wild-type and active site mutants of chitinase A from Vibrio carchariae, as revealed by HPLC-MS pptx
Ngày tải lên :
20/02/2014, 01:20
... wild-type and mutants D392N and E315M, migrating with an Mr of 63 000 (Fig 4A) In the case of the E315Q mutant, an additional faint band was also seen at an Mr of 43 000 This band appeared as a ... hydro- Enzymatic properties of chitinase A from Vibrio carchariae lytic activity of chitinase A resulting in the production of a broad range of chitooligosaccharide products was measured simultaneously ... viscosity assay and HPLC-ESI MS suggested that the newly isolated chitinase acts as an endochitinase [25] We also reported isolation of the gene encoding chitinase A and functional expression of the...
- 11
- 592
- 0
Báo cáo y học: "Segment-orientated analysis of two-dimensional strain and strain rate as assessed by velocity vector imaging in patients with acute myocardial infarction"
Ngày tải lên :
25/10/2012, 11:15
... Germany) we scanned the heart and surrounding structures of 32 patients ECG-triggered in endexspiration and produced the standard views of the long and short axes, as well as the left ventricular outflow ... early diastolic SR (Sre) 0.60 ± 0.35 s-1 The analysis of tissue velocities demonstrated a gradient of systolic (S´) and diastolic (early E´ and late A´) velocities from the apex to the basis of the ... differences between basal, midventricular and apical myocardium (see Table 3) Table 3: Tissue velocities (S´, E´, A´) of basal, mid and apical segments as assessed by VVI S´ (cm/s) E´ (cm/s) Basal 3.64...
- 8
- 683
- 0
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats
Ngày tải lên :
05/09/2013, 09:38
... tidal flats (E1―E5) of the seashore experiment Mountain sand (MS) was used because of its importance as the alternative to sea sand which is of limited availability Mining of sea sand is prohibited ... survived in the mixtures of MS and DS as well as MS itself, however, its growth was dependent on the mixing ratio of DS At 5% silt and clay, the liability and shell length increase of R philippinarum ... Granulation of DS － Untreated 1.5wt% PS 2wt% PAC Mixture of MS and DS* Mixture of MS and DS* Mixture of MS and DS* *Untreated or granulated DS as indicated in this table Sediment Sea sand Sediment...
- 13
- 586
- 0
Thermal properties of the vernacular buildings envelopes: the case of the "Sassi di Matera" and "Trulli di Alberobello
Ngày tải lên :
05/09/2013, 14:58
... consisted of the measurement of thermal conductance of two different typologies of building wall: a wall in blocks of calcarenite sandstone assembled with mortar, typical of the constructions of "Sassi ... measure of conductance The analyses, done in the laboratory of Technical Physics of the Polytechnic of Bari, were performed on some samples of calcarenite sandstone and calcareous stone of Fasano ... Alberobello" In the South of Italy, the sites of the "Sassi of Matera" (Figure 1a) (classified as humanity world heritage in 1993) and "Trulli of Alberobello" (Figure 1b) (classified as humanity world...
- 10
- 507
- 0
Tài liệu Nature and Properties of Micro-organisms doc
Ngày tải lên :
12/12/2013, 17:15
... dura, corneas), ??? blood Resistance to disinfectants Formaldehyde increases infectivity Viruses DNA or RNA Shell of protein (capsid) surrounding nucleic acid Classification on basis of nucleic ... cephalosporins and vancomycin lipoteichoic acid, septic shock Beta-lactamases hydrolyse penicillins and cephalosporins secreted by Gram positive bacteria Within periplasm of Gram negative ... synthesis Classified morphologically: moulds eg Penicillium, Aspergillus yeasts - filamentous, spore-forming - unicellular, budding reproduction eg Candida, Cryptococcus Moulds Yeasts ...
- 35
- 528
- 0
Tài liệu Transformation through Integration An Activity Theoretical Analysis of School Development as Integration of Child Care Institutions and the Elementary School ppt
Ngày tải lên :
16/01/2014, 16:33
... schoolchildren of working or studying parents, or in cases where the child has an individual need A place should be offered as close to the child’s home as possible As in the case of pre-school and family ... Swedish school system has gone through phases of change, as accounted for above, it seems that transmission of basic skills and knowledge remains the main mission However, and as the account shows, ... teaching of groups of children of the same age, (klassundervisning) This practice was established in 1864 using illustrative teaching (åskådningsundervisning) as the pedagogical method This was a...
- 336
- 322
- 0
Electronic and Optoelectronic Properties of Semiconductor Structures
Ngày tải lên :
24/01/2014, 17:34
... electron (hole) transport and optical properties of semiconductors and their heterostructures; and iv) behavior of electrons in small and disordered structures As much as possible I have attempted ... “old” topics such as crystal structure and band theory in bulk semiconductors and “new” topics such as bandstructure of stained heterostructures, self-assembled quantum dots, and spin transistors ... ingots can be obtained In the case of GaAs and InP the CZ technique has to face problems arising from the very high pressures of As and P at the melting temperature of the compounds Not only does...
- 559
- 435
- 0
Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf
Ngày tải lên :
12/02/2014, 19:20
... editing and support Conflict of interest The study was sponsored by Eli Lilly and Company AS and RE are employees and shareholders of Eli Lilly and Company RE and TW were employees of Eli Lilly and ... The sub-domains SS (baseline), 123 EC (baseline and for all visits), IRA (baseline), FI (baseline and for all visits), and SPS (baseline and for all visits) had values between and 5% Higher ceiling ... was 22.2 (SD 3.83), and the hyperactive/impulsive sub-score was 19.6 (SD 6.03) At baseline, mean CGI-S ADHD was 4.8 points (SD 0.89) Baseline total CHIP-CE mean t score was 28.9 (±11.76) (standard:...
- 15
- 1.2K
- 0