proof of proposition 3 1 and proposition 3 2

... proteins VP3, VP2 and a hypothetical protein of BmCPV1, DpCPV1 and LdCPV14, respectively [ 13 , 20 , 21 ] Function of VP3 protein of BmCPV1 is not exactly known but probably codes for spike protein [ 13 ] Therefore ... accession No: HM 23 0 690) Similarly, S3 consisted of 37 84 nucleotides having a long ORF of 36 30 nucleotides and could encode a protein of 12 10 amino acids with molecular mass of ~ 13 7 kDa (p 13 7 ) Twenty ... http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Analysis of recombinant AmCPV S1 and S3 encoded proteins expressed in E coli and insect cells AmCPV S1 and S3 were expressed in E coli M15 cells as insoluble 14 1 kDa (Fig 2A,...

Ngày tải lên: 12/08/2014, 04:20

... matrix J Biol Chem 2 61, 10 765 10 7 71 23 Miles LA, Dahlberg CM & Plow EF (19 88) The cellbinding domains of plasminogen and their function in plasma J Biol Chem 2 63, 11 928 11 934 24 Thewes T, Constantine ... mAb A10 .2 or the K1-LBS by mAb 34 D3 on Lys-Pg only partially inhibits both its binding to fibrin (Fig 3A, IC50 A10 .2 ¼ 29 0 nm, IC50 34 D3 ¼ 420 nm) and its activation (Fig 3B, IC50 A10 .2 ¼ 18 5 nm, ... respectively, cells and fibrin: A10 .2 ¼ 9 .2 nM and nM; 34 D3 ¼ 13 . 1 nM and nM; mAb mix ¼ 11 .8 nM and nM K4-LBS is permanently exposed, supports this hypothesis Blockage by mAb A10 .2 of K4-LBS exposed...

Ngày tải lên: 20/02/2014, 01:20

... 1 10 18 28 84 1 03 11 2 12 5 11 9– 13 2 34 7 36 5 33 8 34 8 36 0 37 2 35 5 37 5 1 .3 mM ND No binding No binding No binding No binding 2. 9 mM mM 40 mM 30 mM mM 2. 0 mM 2. 0 mM ND ND No binding 50 mM 2. 0 mM Binding ... binding 22 23 24 25 26 27 28 29 30 31 32 33 34 35 by cofilin and gelsolin segment substantiates their structural relationship J Biol Chem 27 2, 32 750 32 758 McGough, A., Chiu, W & Way, M (19 98) Determination ... J Biol Chem 2 71, 20 516 – 20 5 23 10 Cunningham, C.C., Stossel, T.P & Kwiatkowski, D.J (19 91) Enhanced motility in NIH 3T3 fibroblasts that overexpress gelsolin Science 2 51, 1 23 3 1 23 6 11 McLaughlin,...

Ngày tải lên: 22/02/2014, 07:20

... 4.05, 3. 75 4. 61 4. 02 3. 74 3. 99 3. 69 a 4. 62 4.99 4.97 3. 32 4.09 3. 76 3. 51 3. 92 3. 95 3. 62 4 .16 4 .36 3. 60 3. 87 3. 97 4.05, 3. 75 3. 95, 3. 73 4. 61 4.96 4. 03 3.58 3. 74 3. 70 4.00 3. 44 3. 69 3. 66 a 3. 87, 3. 77 ... penneri strain 40 41 25 600 < 10 0 < 10 0 32 00 32 00 25 600 < 10 0 < 10 0 32 00 32 00 12 800 < 10 0 < 10 0 < 10 0 < 10 0 12 800 < 10 0 < 10 0 < 10 0 < 10 0 6400 < 10 0 < 10 0 5 12 00 6400 < 10 0 < 10 0 NT NT < 10 0 NT NT O-antiserum ... b-D-GalpNAcII- (1 ® a-D-GlcpII- (1 ® C1 C2 C3 C4 C5 C6 10 5.6 10 2. 6 99.7 74 .3 52. 5 68.8 76.9 81. 6 81 .3 70.4 69 .2 77 .1 75.4 75.7 71. 5 66.8 61. 9 62. 2 10 5 .1 54 .1 72. 5 69 .1 76 .2 62. 5 10 5.6 10 2. 6 99.8 74 .3 52. 4...

Ngày tải lên: 17/03/2014, 17:20

... Sugimura, T (19 90) 24 25 26 27 28 29 30 Calyculin A, an inhibitor of protein phosphatases, a potent tumor promoter on CD -1 mouse skin Cancer Res 50, 35 21 35 25 Li, Y.-M & Casida, J.E (19 92) Cantharidin-binding ... inhibitors of PP1 and PP2A [ 23 , 24 ], showed effects similar to that of OA (Fig 4) Deltamethrin, a specific inhibitor of PP2B [25 ], and phenylarsine oxide, a putative inhibitor of tyrosine phosphatases [26 ], ... post-translationally modified form of tubulin Eur J Cell Biol 42, 28 8 29 4 12 Arce, C.A & Barra, H.S (19 83) Association of tubulinyl-tyrosine carboxypeptidase with microtubules FEBS Lett 15 7, 75–78 13 Sironi, J.J.,...

Ngày tải lên: 23/03/2014, 15:21

... 27 .8 1, 1 81 ± 10 91 8,4 21 ± 2, 684 930 , 916 ± 650,0 21 527 ,5 93 ± 45 ,14 17 33 8 ± 33 0 10 9.0 ± 52. 9 1, 9 62 ± 1, 665 39 .4 ± 32 .1 0. 01 23 0. 014 5 0. 018 5 0. 019 0 0. 022 0 0. 020 9 0. 024 9 0. 02 63 0. 035 2 0. 038 1 0.04 21 ... hsa-miR -19 a hsa-miR -20 0b hsa-miR-5 42- 3p hsa-mir- 625 hsa-miR -10 6b hsa-miR -20 b 4 .11 2. 63 2. 47 2. 43 2. 21 1. 93 1. 92 1. 86 1. 86 1. 81 1.76 1. 73 1. 70 1. 66 1. 63 1. 6 1. 48 1. 43 1. 42 1 .33 1 . 31 hsa-miR- 13 3 a hsa-miR-504 ... 26 † 49 ± 33 *† 82 ± 16 73 ± 23 * 58 ± 27 † 64 ± 24 23 ± 29 89 ± 62 ± 35 82 ± 26 * 20 0 ± 11 5 37 7 ± 2 21 2, 725 ± 8 53 23 7 ± 61* 566 ± 29 0† 15 5 ± 67 4 41 ± 4 43 890 ± 33 6* 2 53 ± 10 7* 2, 0 12 ± 10 88* % Reactive...

Ngày tải lên: 18/06/2014, 15:20

... |Dn | = 2n (n + 1) n 1 In this section we give a generalization of this result the electronic journal of combinatorics 11 (2) (20 05), #N3 D= 10 12 f 11 9 γ◦φ 11 10 11 10 =F bi Figure 3: The bijection ... ≥ 1, fn (t) is given by n 1 (i + 1) t + (n − i) (11 ) (2i + 1) t + (n − i) ( 12 ) fn (t) = t i =1 For n ≥ 1, pn (t) is given by n 1 pn (t) = t i =1 Note that (11 ) and ( 12 ) are generalizations of ... generalizations of |Tn +1 | = (n + 1) n and |Pn +1 | = (n + 1) ! Cn Remark In spite of the simple expressions, we have not proved (8), (11 ) and ( 12 ) in a bijective way Also a direct combinatorial proof of Theorem...

Ngày tải lên: 07/08/2014, 08:22

... electronic journal of combinatorics 15 (20 08), #R68 3 X X X 0 Figure 5: The partial Latin square equivalent {000, 011 , 022 , 10 1, 11 0, 13 3 , 20 2, 2 13 , 2 21 , 23 0 , 30 3, 32 0, 33 2} to the code Figure ... vertices of degree six, 11 2, 13 0 , 33 2, 31 0, GB has only three vertices of degree six, 13 2 , 33 1, 31 2 LA, LB, LC and LD are non-equivalent There are four non-equivalent (3, 10 , 2) 4 codes Theorem 15 No ... S( 23 ) squares with row of 0 12 X, 021 X and 023 X are equivalent to squares with row of 013 X, 0 31 X and 0 32 X respectively Thus only nonextendable partial Latin squares with row of 0 12 X, 021 X and 023 X...

Ngày tải lên: 07/08/2014, 15:23

... et al Journal of Experimental & Clinical Cancer Research 2 011 , 30 :16 http://www.jeccr.com/content /30 /1/ 16 Received: 30 September 2 010 Accepted: February 2 011 Published: February 2 011 References ... (Table 2) Restage before RIT: CT, PET, BMB Zevalin® FCR -28 CYCLES 11 .1- 14.8 MBq/Kg CR/CRu or PR F: 25 mg/m2 i.v days 1 -3 C: 1gr/m2 i.v day R: 37 5mg/m2 i.v day Figure Treatment schema Restage 12 weeks ... cycles of FCR: fludarabine at a dose of 25 mg/m2 i.v on days to 3; cyclophosphamide at a dose of gr/m2 i.v on day and rituximab Page of at a dose of 37 5 mg/m2 was given on day of each cycle every 28 ...

Ngày tải lên: 10/08/2014, 10:21

... transfection and reporter gene assays COL1A1 Hs0 016 4099_m1 TIMP -1 Hs0 017 1558_m1 MMP -1 Hs00 23 3 958_m1 MMP -2 Hs00 23 4 422 _m1 HsEEF1A1 CACCTGAGCAGTGAAGCCAGCTGCTT DNA pull-down assay Biotin-MMP -1- S GATCGAGAGGATGTTATAAAGCATG ... 4, 12 11 Geneva 14 , Switzerland and 2Department of Pathology and Immunology, Geneva University Hospital and School of Medicine, rue Michel Servet 1, 12 11 Geneva 14 , Switzerland 19 Received: 10 ... 19 Received: 10 December 20 09 Revised: April 2 010 Accepted: 29 April 2 010 Published: 29 April 2 010 21 20 ArthritisGoffin et al.;Therapy 2 010 , 12 :R 73 under the terms of the Creative Commons Attribution...

Ngày tải lên: 12/08/2014, 12:20

... 17 1. 9 Cooperative and distinct functions of HDAC1 and 18 1. 9 .1 Redundancy of HDAC1 and HDAC2 functions 18 1. 9 .2 Distinct functions of HDAC1 and HDAC2 19 1. 10 Inhibition of ... 20 1. 11 Biological effects and mechanisms of action of HDAC inhibitors 20 1. 11. 1 Apoptosis 20 1. 11. 2 Growth arrest 22 1. 11 .3 Mitotic disruption and autophagy ... 51 3. 11 HDAC Activity Assay 52 3. 11 .1 Extraction of nuclear protein 52 3. 11 .2 Fluorometric HDAC Activity Assay 52 3. 12 RNA isolation 53 3. 13 Microarray...

Ngày tải lên: 10/09/2015, 08:27

... - 32 0 +1 Luc -15 4 E2 +1 +1 Luc -975 +1 Luc - 32 0 Prm3 -19 79 - 13 9 4 +1 Luc +1 Luc -404 Prm2 E1b -33 08 - 13 9 4 +1 Luc -975 E1 -5895 -8500 +1 Luc -15 4 +1 Luc -10 6 +1 Luc -50 pGL3Basic +1 Luc +1 Luc +1 ... Prm3 activity In contrast, further 5¢ -11 8 +1 + 11 9 +786 E2 +1 Luc -11 8 Luc +11 9 Luc 10 Luciferase Activity (RLU) B - 13 9 4 -404 -11 8 +1 +1 19 +786 E2 +1 Luc **** FEBS Journal 27 2 (20 05) 1 036 10 53 ... AP -1 +1 Promoter Luciferase Activity (RLU) AP -1 - 13 9 4 +786 - 13 9 4 E2 - 13 9 4 +1 Luc - 13 9 4 +1 Luc - 13 9 4 +1 Luc **** +1 Luc +786 E2 *** - 13 9 4 +1 Promoter -404 +1 Luc +1 Luc -15 4 +1 Luc +1 Luc -15 4 +1...

Ngày tải lên: 19/02/2014, 16:20

... hydrolase 0.007 0.0 23 0 .24 0. 83 3.9 28 .0 30 .1 50.5 ± ± ± ± ± ± ± ± 0.0 02 0.008 0.04 0 .15 0.7 4 .1 3. 0 7 .3 Ó FEBS 20 03 Anti-HIV -1 activity of 3- deaza-adenosine analogs (Eur J Biochem 27 0) 35 11 hydrolase ... 0.005a 0.001a 0.06a 0 .3 0.06a 0.4 0 .3 0 .3 A 018 isolate 0. 018 0. 016 0 .22 2. 84 0 .20 4.8 2. 5 2. 0 ± ± ± ± ± ± ± ± 0.009a 0.005a 0.02a 0 .3 0.02a 0 .2 0 .3 0 .2 The IC50 values from Mayers et al [10 ] Ki (lM) ... AA -2 (AK–, dCK–) V79 (TK+) V79 (TK–) 0.64 0.59 3. 4 2. 6 0 .25 0 .28 1. 0 1. 4 ± ± ± ± 0.07 0.09 0 .27 0 .10 ± ± ± ± 0. 03 0. 02 0.05 0.06 35 12 R K Gordon et al (Eur J Biochem 27 0) Ó FEBS 20 03 amount of 3- deaza-nucleotides...

Ngày tải lên: 08/03/2014, 08:20

... 27 82 [3] G Medeiros-Ribeiro et al., Science 27 9 (19 98) 35 3 [4] J Knall, J.B Pethica, Surf Sci 26 5 (19 92) 15 6 [5] H Omi, T Ogino, Appl Phys Lett 71 (19 97) 21 63; H Omi, T Ogino, Phys Rev B 59 (19 99) ... Phys Lett 76 (20 00) 35 34 [10 ] P M€ ller, R Kern, Surf Sci 457 (20 00) 22 9 u [11 ] F.M Ross, J Tersoff, R.M Tromp, Phys Rev Lett 80 (19 98) 984 [ 12 ] J Tersoff, Phys Rev B 43 (19 91) 937 7 ... all of the side faces of elongated islands are faceted with (1 9)/(5 9) at an angle of 16 ° with respect to the substrate surface, their 3 Š ends are faceted with (15 17 ), (1 1) and (3 15 17 )...

Ngày tải lên: 16/03/2014, 15:34

... and human (AGP1_HUMAN; Q1 538 9 and AGP2_HUMAN; O1 51 23 ) (iv) Ficolins: ficolin A and B from pig (FICOLA_PIG; L1 23 4 4 and FICOLB_PIG; L1 23 4 5), mouse (FICOLA_MOUSE; AB0078 13 and FICOLB_MOUSE; AF0 6 32 17 ), ... AB 024 737 .1 and TECL5B_TACTR; AB 024 738 .1) (iii) Angiopoietin: angiopoietin and precursors from mouse (AGP1_MOUSE; O08 538 and AGP2_MOUSE; O35608), bovine (AGP1_BOVIN; O18 920 and AGP2_BOVIN; O778 02) , ... nucleotides 10 0 10 2 to nucleotides 22 42 22 44(stop); the Ó FEBS 20 04 Activation of sponge cells by (1 3) -b-D-glucan (Eur J Biochem 2 71) 19 29 Fig The Suberites domuncula potential beta -1 ,3- glucan-binding...

Ngày tải lên: 16/03/2014, 16:20

... ) 1 03: Vmax (mmol:min 21 : mg 21 ) 1 03: (Vmax/Km) (min 21 : mg 21 ) ln (Vmax/Km) G3G G3G3G G3G3G3G G3G3G3G3G G3G3G3G3G3G 16 .5 5.0 1. 9 2. 0 2 .1 0 .36 5.5 14 16 18 0. 02 1. 1 7.4 8.0 8.6 21 0 . 73 26 .80 24 . 91 24 . 83 ... 12 5 70 15 630 570 440 31 5 2 83 25 2 2. 5 4.6 6 .3 21 47 63 1. 8 2. 5 8.4 18 .8 25 .2 10 0 90 70 50 45 40 6 12 6 A A Kulminskaya et al (Eur J Biochem 26 8) q FEBS 20 01 General properties Fig SDS/PAGE of the ... G4G4G3G and G4G3G were produced by digestion of barley glucan with a 1 ,3- 1, 4-bglucanase and purified [26 ] The G3G3G3G3G3G, G3G3G3G3G, and G3G3G3G were prepared by formic acid hydrolysis of curdlan...

Ngày tải lên: 24/03/2014, 04:21

... mature and greatly magnified Stages in the formation of the polar bodies in the ovum of a star-fish Fertilization of the ovum of an echinoderm 10 0 10 7 11 1 1 13 12 1 12 2 1 23 12 5 12 6 Fertilization of ... segmentation, drawn in perspective Formation of the gastrula of Amphioxus Gastrulation Gastrula of a Chalk Sponge 12 7 12 9 13 1 13 2 , 13 3 13 5 13 5 13 7 13 8 13 9 Prophysema primordiale, an extant gastræa-form ... Skeleton of Polar Bear 16 7 16 8 16 8 16 8 16 8 16 8 16 9 16 9 17 0 17 0 17 1 17 1 17 2 17 4 Skeleton limb of Man, Dog, Hog, Anterior of Lion Sheep, and Horse Posterior limb of Man, Monkey, Dog, Sheep, and Horse...

Ngày tải lên: 28/06/2014, 19:20

... 547.87 10 71. 0 44. 010 4 93. 0 28 .0 13 22 7 .3 34.076 1 036 .0 6 72. 6 34 3 .37 16 .0 43 667.8 707.0 30 .070 550.09 44.097 616 .3 666. 01 734 .98 529 58 . 12 4 58 . 12 4 550.7 765.65 490.4 72 .15 1 829 ,10 488.6 845.70 72 .15 1 ... 4.696 psia at Boiling Point, Btu/lb 21 9 .22 21 0 . 41 1 83. 05 16 5.65 15 7. 53 1 53. 59 14 7. 13 1 43. 95 13 6 . 01 129 . 53 1 23 . 76 11 8.68 40 Design of GAS-HANDLING Systems and Facilities Natural Gas Sensible Heat ... Shear Ring 20 21 22 23 24 25 26 27 , 28 29 30 31 32 33 34 35 36 37 38 39 Slip-on Backing Flange Floating Head Cover—External Floating Tubesheet Skirt Packing Box Packing Packing Gland Lantern...

Ngày tải lên: 06/08/2014, 02:20

... inhibited by 36 % (P < 0 .1) with 30 0 nM CDDO, by 49% (P < 0. 01) with µM CDDO, and by 83% (P < 0. 01) by µM CDDO Similar patterns emerged for MMP- 13 ( 63% , 81% , and 99%) and Bcl -3 (33 %, 61% , and 86%) ... decreased expression of IL -1- induced MMP -1 and MMP- 13 MMP -1 expression was decreased by 99% (P < 0. 01) and MMP- 13 by 96% (P < 0. 01) As was observed with SW 13 5 3 cells, MMP- 13 expression was significantly ... SW- 13 5 3 and human primary chondrocytes (data not shown) Effect of overexpression of Bcl -3 on the inhibition of MMP -1 by CDDO To examine further the role of Bcl -3 in IL -1- induced MMP -1 and MMP -13 ...

Ngày tải lên: 09/08/2014, 01:23

... -2, -3, -11 ,- 13 , -1 -2, -3, -11 ,- 13 , -1 -1, -2, -11 -1, -2, -3, -11 ,- 13 -1, -2, -3 -2 -1, -11 -1 -1, -2, -3, -11 ,- 13 -1, -2, -3, -11 ,- 13 -1, - 13 -1, -2, -3, -11 -1 -1, -2, -3, -9, -11 ,- 13 -1, -2, -3, -11 ,- 13 -1 -1, -2, -3 -1, -2 -1, -2, -3, -11 ,- 13 , ... -1, -2, -3, -11 ,- 13 , -1 -1, -9 -1, -2 -1, -3, -11 -1 -1, -2, -3 -1, -11 -1, -3, -11 -11 -1, -3, -11 -1, -2, -3, -11 -2 -1, -2, -3, -9, -11 -1, -3 -1, -2 -1, -2 -1 -1 -1, -2 -1, -2 -1, -2 -1, -2, -3, - 13 -1 -1, -3, -9 -2 -1, -11 -1 ... -1, -2, -11 -2 10 11 12 13 14 15 16 17 18 19 20 Endothelium -11 -1, -9, -11 -1, -11 -1, -11 -2 -1, -2, -3, -9, -11 -1 -1, -3, -11 -1, -9, -11 ,- 13 -1, -2 -3, -9, -11 Epithelium -1, -2, -3, -11 ,- 13 -1 -2, -3, -11 ,- 13 , ...

Ngày tải lên: 09/08/2014, 07:22