project cashflow of a filed life cycle

... the alternatives according to the goal or decision criterion, and select the best alternative 1.1.4 Advantages of DA - DA has many advantages , such as its comprehensiveness and vitality as a model ... graph provides a visual indication of the range of probability over which various alternatives are optimal, and the algebra provides exact values of the endpoints of the ranges Table 1.2 State ... amount of production data available Reserve estimates variable Dependent on amount of production history available 2323 Petroleum Project Making Decision In Oil Field Life Cycle is available Analogy...

Ngày tải lên: 24/09/2016, 22:06

Ngày tải lên: 23/03/2014, 01:20

... of metastases mainly depends on histological parameters Although most solitary fibrous tumours are characterized by a non-aggressive clinical course, some can recur locally or display malignant ... muscle actin and A, B,C: tumor consists of a proliferation of bland-looking cells admixed with thin collagen fibers Figure The A, B,C: The tumor consists of a proliferation of bland-looking cells admixed ... -/+ +/- -/+ - Inflammatory myofibroblastic tumor * Leiomyoma Metaplastic carcinoma Myoepithelioma Pseudoangiomatous stromal hyperplasia mild abundant no no no no red cell extravasion no +/- + -...

Ngày tải lên: 09/08/2014, 07:21

... 737-8 Castillo JG, Silvay G: Characterization and management of cardiac tumors Cardiothorac Vasc Anesth 2010, 14(1):6-20 Patel J, Sheppard MN: Pathological study of primary cardiac and pericardial ... neoplasms with Leiomyosarcomas to consist of 8% of cardiac sarcomas [6,7] As per Kim et al [8] angiosarcomas and unclassified sarcomas are the most common sarcomas of the heart accounting for 76 %of ... Computerized Tomogram demonstrating right atrial wall tumor which appears to be lobulated, irregular and of low attenuation Page of Figure Transthoracic Echocardiogram demonstrating right atrial tumor...

Ngày tải lên: 10/08/2014, 09:22

... papillary fibroelastoma of the aortic valve in a young woman -a case report Cardiovascular Ultrasound 2009, 7:43 Sato Y, Yokoyama H, Satokawa H, Takase S, Maruyama Y: A report of a surgical case of ... report of two cases and review of the literature Annals of Clinical & Laboratory Science 2001, 31(3):291-296 Parthenakis F, Nyktari E, Patrianakos A, Pitsis A, Asimaki A, Vardas P: Asymptomatic papillary ... Papillary fibroelastoma of the aortic valve - a case report and literature review Journal of Cardiothoracic Surgery 2010 5:84 Author details Division of Adult Cardiac Surgery, Institute of Cardiac...

Ngày tải lên: 10/08/2014, 09:22

... differential diagnosis can be narrowed down to AAM, AMF, and SFT as follows: (1) AAM has a highly infiltrative pattern Conclusion Cellular AF is a benign neoplasm of the scrotal and inguinal area, is ... Cellular angiofibroma: clinicopathologic and immunohistochemical analysis of 51 cases Am J Surg Pathol 2004, 28:1426-1435 Canales BK, Weiland D, Hoffman N, Slaton J, Tran M, Manivel JC, Monga M: Angiomyofibroblastoma-like ... fibroblasts, and of vascular origin A safe initial diagnosis is difficult because of its location, nature, and correlation with other structures of the area It can easily be confused with a hernia,...

Ngày tải lên: 10/08/2014, 23:20

... ligation small and are usually discovered incidentally because patients are asymptomatic, though sometimes there can be epigastric or left upper quadrant abdominal pain Malignant transformation ... subdiaphragmatic masses, even in intraperitoneal location Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of ... rare cause of a mass in the adrenal region J Clin Pathol 2001, 54:801-802 18 Foerster HM, Sengupta EE, Montag AG, Kaplan EL: Retroperitoneal bronchogenic cyst presenting as an adrenal mass Arch...

Ngày tải lên: 11/08/2014, 02:21

... effects of intra-articular lead implants on the synovium, articular cartilage and meniscus of white rabbits at 4, 6, 10 and 14 weeks Articular and meniscal changes that Harding et al came across were ... mechanical destruction of joint may be caused by several factors Firstly the initial trauma may cause fractures of articular bone, leading to an incongruous and irregular joint surface Motion of ... Experimental Lead Arthropathy: An Animal Model Journal of Trauma-Injury Infection & Critical Care 1999, 47(5):951 Bolanos A A, Demizio JP Jr, Vigorita V J, Bryk E: Lead poisoning from an intraarticular...

Ngày tải lên: 11/08/2014, 10:23

... whole brain irradiation up to 30 Gy with a daily Gy fractionation and was then returned to supportive care Case presentation In January 2006, a 40-year-old Caucasian man underwent a non radical resection ... uptake value of tracer: maximum standardized uptake value values are reported for each lesion before and after treatment Page of (page number not for citation purposes) Journal of Medical Case ... therapy in the palliative management of advanced salivary gland cancers J Clin Oncol 2006, 24:2673-2678 Agulnik M, Siu LL: An update on the systemic therapy of malignant salivary gland cancers:...

Ngày tải lên: 11/08/2014, 21:22

... Figure antero-lateral of surgical through Intra-operative picture approach debridement of thigh Intra-operative picture of surgical debridement of thigh through antero-lateral approach Patient made ... right in vastus latralisinflammatory stranding and Figure of CT scan of right thigh, showing inflammatory stranding and low attenuation in vastus latralis (arrow) lace technique IV antibiotics were ... fluctuance and systemic evidence of sepsis such as hyperthermia, tachycardia and hypotension are alarming signs Diagnostic tools Early diagnosis of NF is not always possible due to paucity of cutaneous...

Ngày tải lên: 13/08/2014, 23:20

... complexes of inhibitory substrate analogues derived from acarbose and barley a- amylase (AMY2 [16]); and Taka-amylase A (TAA [17]) (A) Stereo view of interactions involving segments of ba loops and ... Bacterium Bacterium Bacterium Bacterium Yeast Bacterium Archaea Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Plant Plant a- Amylase Barley ... domain B) from AMY2 (in green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2...

Ngày tải lên: 31/03/2014, 08:20

... article as: Kayhan and Başaran: Typical carcinoid tumor of the larynx in a woman: a case report Journal of Medical Case Reports 2010 4:321 Submit your next manuscript to BioMed Central and take ... Acknowledgements Grateful thanks to Yasemin Özlük, of the Department of Pathology at the University of Istanbul, Istanbul Faculty of Medicine, for technical assistance, and to Lutfi Kanmaz and Arzu Koç Authors’ ... vascular invasion are found in atypical carcinoid tumor The prognosis of atypical carcinoid tumor is poorer than that of typical carcinoid tumor, with a 5-year survival rate of approximately...

Ngày tải lên: 11/08/2014, 02:21

... populated countries of the world, with a population of about 129 million in 2001(Bangladesh Bureau of Statistics, 2002) Dhaka is the capital city of Bangladesh, and Bauniabad is one of the urban ... at the stage of planning and implementation of water and sanitation options Educational intervention on water and sanitation: 1995-1997 The educational intervention on water and sanitation was ... water and sanitation project in Bauniabad since 1993 The activities are divided into four phases: (i) Water and sanitation evaluation in 1993; (ii) Educational intervention on water and sanitation...

Ngày tải lên: 05/09/2013, 09:08

... ngày) are artful (As artful (or clever) as a wagonload of monkeys), funny 4.1.2.2 Buffalo (Be more fun than a barrel of monkeys), restless and agitated (Like a Buffaloes are very sturdy animals ... Vietnamese VZA frequencies of occurrence of VZAs are different among animals and words, and compares the VZA images and their connotations A between the two languages Horse and pig are more popular ... will offer them a metaphorical and metonymical ways According to CMT, people clearer insight into the use of idioms and proverbs relating to VZAs have often resorted to animals as a way of explaining...

Ngày tải lên: 26/11/2013, 13:29

... important and significant characteristics of the WDBs As a result, the topic A Contrastive animals that nature has provided to feed both our body and spirit As Analysis of the Semantic and Pragmatic ... Crow a Appearance: “crow’s feet”, “crow’s beak”, “as hoarse as a crow”, “as black as crow” b Colour: “as black as crow” 4.1.1.9 Owl a Fret: “as mad as a wet hen” a Diligence: “night owl” b Talkativeness: ... Hawk: a Appearance: “hawk’s eyes”, “hawk nose” 4.1.1.7 Eagle a Appearance: “eagle eyes”, “eagle nose”, “eagle glance”, “young eagle”, “as big as an eagle” b Movement: “follow like an eagle” 4.1.1.8...

Ngày tải lên: 26/11/2013, 13:30

... representative sampling from a larger number of such registrations revealed by his search Ser No 75/934,127 Applicant filed a Notice of Appeal with the Trademark Trial and Appeal Board, along with a ... application The Examining Attorney again found these arguments unpersuasive, and he issued an Office Action to that effect The Board instituted the appeal and both applicant and the Examining Attorney ... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments,...

Ngày tải lên: 20/12/2013, 23:15

... pAM237 pAM241 pAM252 pAM253 pAM872 pAM873 pAM874 pAM875 pAM876 pAM877 pAM878 pAM879 pAM880 pAM881 pAM882 pAM883 pAM884 pAM885 pAM886 pAM887 pAM888 pAM889 pAM890 pAM891 pAM892 pAM895 pAM896 pAM899 ... GFP-specific antiserum was a gift from J Kahana and P Silver (Dana Farber Cancer Center, Boston, MA) The anti-actin mAb was MAB1501 from Chemicon International (Temecula, CA) The anti-hexokinase rabbit ... bar1) [23], IDY166 (MATa his3 leu2 ura3 trp1 las17D::URA3) [20], and PJ69- 4A (MATa his3 leu2 ura3 trp1 gal4D gal80D met2::GAL7-lacZ GAL2-ADE2 LYS2::GAL1–HIS3) [64] Yeast strain PJ69- 4A was a...

Ngày tải lên: 18/02/2014, 16:20

... ligand had a cooperative character It leads to higher uorescent response and better xation of CBC Final stabilization of IF30CBCIF20 can occur after series of transitions at the domaindomain ... detecting chip (Fig 6) All the above facts mean that the intestinal uptake of analogues can be quite feasible In this regard we plan to examine a group of analogues concerning details of their binding ... corresponds to change of absorbance at wavelength 352 nm in the reaction sample after incubation time t; DAmax ẳ jACNCbl AH2 OCbl j stands for maximal poss352 ible change in the amplitude at wavelength,...

Ngày tải lên: 19/02/2014, 05:20

... GGTTGCCTGAGRTGYATHTGa GGGCTATTGGTCAGACGCTACACTC GAGTGTAGCGTCTGACCAATAGCC GATCTGATACGGTCCACACGACAG GCLRCIC GYWSDATL GYWSDATL LSCGPYQI H ¼ A or C or T; R ¼ A or G; Y ¼ C or T transcription The cDNA was ... lysozyme of the bivalve Tapes japonica [3], with the so-called chlamysin of Chlamys islandica [4,5], and also with a hypothetical secreted protein of the nematode Caenorhabditis elegans and with putative ... was treated with RNAase-free DNAase I (Pharmacia) for 30 at 37 °C cDNA was synthesized by reverse transcription from DNAase-treated RNA using Moloney murine leukaemia virus reverse transcriptase...

Ngày tải lên: 19/02/2014, 12:20

... Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National Laboratory, and the Department of ... Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering viii Acknowledgments The committee wishes to thank all of the members of the Partnership ... Jersey Staff JAMES ZUCCHETTO, Director RICHARD CAMPBELL, Program Officer ALAN CRANE, Program Officer MARTIN OFFUTT, Program Officer SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant...

Ngày tải lên: 06/03/2014, 15:20