programming the parallel port in c
Cambridge.University.Press.Press.Politics.and.the.Public.Sphere.in.Europe.and.North.America.1760-1820.Jul.2002.pdf
Ngày tải lên :
21/09/2012, 10:58
... from
the scrutiny of this new rational-critical public. This being the case,
the opinion of the public increasingly assumed the role of a legitimis-
ing tribunal which
judged the acts of political ... Ryan, Civic Wars: Democracy and Public Life in the American City During the
Nineteenth Century (Berkeley, CA, ).
See for example Charles E. Clark, The Public Prints: The Newspaper in Anglo-
American ... codification and cataloguing
of information and new processes of data collection. Whereas continual
copying of manuscripts in scribal culture led to the cumulative corruption
of texts, print culture...
- 275
- 861
- 2
Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"
Ngày tải lên :
25/10/2012, 10:06
... traditional Chinese
medicine in Hong Kong Special Administrative Region, China. J Altern
Complement Med 2007, 13(3):361-7.
9. Licensing of Chinese Medicines Traders, Chinese Medicine Council of
Hong ... The Chinese
University of Hong Kong, Shatin, Hong Kong, China.
Authors’ contributions
VCHC, CHL and SMG conceived the research idea. CHL conducted the
statistical analysis. VCHC interpreted the ... with Chinese medicine practitioners
A total of 19.0% of the population used Chinese OTC
medications only whereas 7.2% used both Chinese medi-
cine consultation and Chinese OTC medication in the
previous...
- 9
- 516
- 0
Báo cáo y học: "Aplasia and Agenesis of the Frontal Sinus in Turkish Individuals: A Retrospective Study Using Dental Volumetric Tomograph"
Ngày tải lên :
25/10/2012, 11:04
... positioning light was centered at the level of
the sinus, indicating the optimized center of the re-
construction area. In addition, the head position was
adjusted in such a way that the hard ... 17-19].
Occasionally, one or both sinuses may be absent. The
prominence of supercilliary arcs does not indicate the
absence, presence or size of the frontal sinus [3].
The objective of this ... facial bones [8].
The exact drainage system of the frontal sinus
depends on its embryologic development [2,13]. The
drainage usually occurs directly into the frontal recess
[14] or into the...
- 5
- 577
- 0
Báo cáo y học: "Transporter Molecules influence the Gene Expression in HeLa Cells"
Ngày tải lên :
03/11/2012, 11:44
... different concentra-
tions of TPs showed an influence on the behaviour of
the cells, which may alter the biochemical effect of the
transported cargo and which could consequently in-
fluence the interpretation ... tgaccttgatttattttgcatacc
Right 218-237 20 55 cgagcaagacgttcagtcct
HMBS NM_001024382.1 Left 580-597 18 61 tgtggtgggaaccagctc
Right 653-671 19 47 tgttgaggtttccccgaat
Int. J. Med. Sci. ... 480-499 20 55 gcaaacagagtgagcccttc
Right 551-569 19 58 ggccagccacataggagtt
ALAS NM_000688.4 Left 1867-1889 23 43 catgagacagatgctaatggatg
Right 1936-1955 20 45 ttttagcagcatctgcaacc
Hprt1 NM_000194.1...
- 10
- 449
- 0
Báo cáo y học: "An innovative method to evaluate the suture compliance in sealing the surgical wound lip"
Ngày tải lên :
03/11/2012, 11:52
... maintaining the wound-margin coales-
cence during the first 24-72 hrs following operation,
thus complying with the remodeling of the wound
volume resulting from the clearance of edema in the ... poor Abdominal, thoracic, subcutane-
ous, intestinal, vascular, pediatric,
plastic, oncology, orthopedic
PANACRYL: glycolide and lactide
copolymer coated by caprolactone and
glycolide
braided ... water-proof property across the sutured line.
The clinical pilot study using epidermal hydrocolloid
thin layer coating was found to be very effective in
detecting the proper tension of each knot. This...
- 7
- 602
- 0
Tiểu luận tiếng anh : Robinson Crusoe – A Representative of the English Bourgeoisie in the early 18th century
Ngày tải lên :
26/11/2012, 12:02
... and working in such factories. England became a
typical example of initial accumulation of capitalism. Holding power in
economics, the English bourgeoisie further encroached on the politic field. ... field.
They became the driving force in the English society. After actually
overthrowing the feudalism and establishing the Institutional Monarch system,
they led the country to the capitalist ...
PART C: CONCLUSION
“ Robinson Crusoe” is the most famous and successful novel of Daniel
Defoe. The charm of this story mainly lies in its intense reality, in the
succession of thought, feelings...
- 15
- 2.3K
- 9
John Wiley and Sons - The Portable MBA in Project Management
Ngày tải lên :
07/02/2013, 09:32
... become synonymous for project scheduling tech-
niques. (Both PERT and CPM were much more than scheduling techniques, but
the scheduling graphics they produced, called PERT charts and Critical ... product management, including
Winning at New Products: Accelerating the Process from Idea to Launch,
which has sold over 100,000 copies. He is president and cofounder of The
Product Development Institute, ... However, these factors are merely
proof that this discipline is becoming a necessary skill in most organizations.
The root cause of the growing use of project management is the increasing rate
of change...
- 459
- 662
- 11
TYPHOONS AND TECHNICAL SOLUTIONS RECOMMENDED FOR EXISTING AND NEW HOUSES IN THE CYCLONIC REGIONS IN VIETNAM
Ngày tải lên :
01/04/2013, 22:47
... also considered in this map. During
recent 20 years, some research were conducted with objectives to provide the guidelines for construction (including
planning) in the cyclonic and flooding ... the information about the typhoons in Vietnam and the technical solutions recommended for
existing and new houses in the tropical cyclonic areas considering the local conditions. Houses in the ... remain significant. The coastline in this region is in the Northwest-
Southeast direction, which coincides with the path of the cyclonic flows. Therefore, many typhoons after hitting the
region...
- 12
- 584
- 0
A Contrastive Analysis between the Verb ‘Run’ in English and the Verb ‘Chạy’ in Vietnamese
Ngày tải lên :
06/04/2013, 08:43
... thiệu cuốn sách c a một nhà báo tên tuổi c c i tên
rất ấn tượng là Chạy. Theo cuốn sách đó, bây giờ ở ta, chả c c i gì là không phải
chạy: Chạy ch c, chạy quyền, chạy bằng, chạy tuổi, chạy c ... function, to the manner in which they are acquired by children, to
the psychological mechanisms that underlie the production and reception of speech, to the
literary and the aesthetic or communicative ... take into account the constraints that include context, the rules of
grammar of the two languages, their writing conventions, and their idioms. Therefore, there
exists a common misconception...
- 52
- 1.9K
- 25
A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son
Ngày tải lên :
07/04/2013, 23:51
... establishes Internet
channels can choose to introduce new products or services to customers. Not only in the
Internet channel a direct connection to customers or to any participant in the value chain, ... to work each day for a company that produces a
product, that is yet another link in the chain of commerce.
When you think about commerce in these different ways, you instinctively recognize several ... switching theory in July 1961
and the first book on the subject in 1964. Kleinrock convinced Roberts of the theoretical
feasibility of communications using packets rather than circuits, which was a...
- 58
- 472
- 0