programming 8 bit pic microcontrollers c pdf
Programming 8-BIT PIC Microcontrollers in C with interactive hardware simulation pot
... Labcenter Electronics Ltd. Custom Computer Services Inc. ( www.ccsinfo.com ) Custom Computer Services Inc. specializes in compilers for PIC microcontrollers. The main range comprises PCB compiler ... xv www.newnespress.com Links, Resources, and Acknowledgments Microchip Technology Inc. ( www.microchip.com ) Microchip Technology Inc. is a manufacturer of PIC ® microcontrollers and associated products. ... Compiler (Custom Computer Services CCS C) ● PIC programming and in-circuit testing (Microchip ICD2) Figure 1.22 : ICD Debugging Windows Ch01-H8960.indd 30Ch01-H8960.indd 30 6/10/20 08 4:57: 08 PM6/10/2008...
Ngày tải lên: 06/03/2014, 17:20
Tài liệu Programming C# pdf
... New Project window. Figure 2-1. Creating a C# console application in Visual Studio .NET Programming C# 13 use. The CLR's garbage collector checks the heap for unreferenced objects and ... int myChoice = Libertarian; switch (myChoice) { case Democrat: Console.WriteLine("You voted Democratic.\n"); break; case LiberalRepublican: // fall through //Console.WriteLine( ... interact with COM components created outside the managed environment of the .NET Framework. It is possible to call components from C# applications into COM and to call components from COM into C# ....
Ngày tải lên: 10/12/2013, 14:16
Tài liệu Programming with C# pdf
... object-oriented programming. Use common objects and references types. Create, initialize, and destroy objects in a C# application. Build new C# classes from existing classes. Create ... sample. xii Programming with C# Trainer Materials Compact Disc Contents The Trainer Materials compact disc contains the following files and folders: Autorun.exe. When the CD is inserted ... setting up the classroom computers. 212 4C_ sg.doc. This file is the Automated Classroom Setup Guide. It contains a description of classroom requirements, classroom configuration, instructions for...
Ngày tải lên: 21/12/2013, 06:16
Tài liệu Thiết kế máy thu phát ký tự 8 bit, chương 6 pdf
... giải phóng cho vi xử lý khỏi c ng vi c trên, trong đề tài này lựa chọn giải pháp dùng phần c ng. C nhiều dạng vi mạch chuyên dụng th c hiện c hai ch c năng là: 82 7 9C (Intel) 80 48, 80 42 (Intel) ... (Intel) ph c vụ bàn phím máy vi tính PC. Vi mạch đư c lựa chọn cho phần hiển thị và quét phím c a hệ thống là 82 7 9C. 4.3.3.Giới thiệu vi mạch 82 7 9C. Đây là vi mạch chuyên dụng ph c vụ cho vi c quét ... t c gạt hai trạng thái UP/DOWN chuyển trạng thái ho c t c động theo sườn lên c a xung clock ho c t c động theo sườn xuống c a xung clock. 4.3.5. LẬP TRÌNH KHỞI TẠO CHO VI MẠCH 82 79. Vi mạch...
Ngày tải lên: 24/12/2013, 14:16
Tài liệu 8-bit Microcontroller with 8K Bytes In-System Programmable Flash pdf
... AT89S52-24AC AT89S52-24JC AT89S52-24PC AT89S52-24SC 44A 44J 40P6 42PS6 Commercial (0 C to 70 C) AT89S52-24AI AT89S52-24JI AT89S52-24PI AT89S52-24SI 44A 44J 40P6 42PS6 Industrial (-40 C to 85 C) 33 4.5V to 5.5V AT89S52-33AC AT89S52-33JC AT89S52-33PC AT89S52-33SC 44A 44J 40P6 42PS6 Commercial (0 C ... Units 1/t CLCL Oscillator Frequency 3 33 MHz t CLCL Oscillator Period 30 ns t SHSL SCK Pulse Width High 8 t CLCL ns t SLSH SCK Pulse Width Low 8 t CLCL ns t OVSH MOSI Setup to SCK High t CLCL ns t SHOX MOSI ... after SCK High 2 t CLCL ns t SLIV SCK Low to MISO Valid 10 16 32 ns t ERASE Chip Erase Instruction Cycle Time 500 ms t SWC Serial Byte Write Cycle Time 64 t CLCL + 400 µs 18 AT89S52 1919B–MICRO–11/03 Oscillator...
Ngày tải lên: 25/12/2013, 05:17
Tài liệu Thiết kế máy thu phát ký tự 8 bit, chương 18 pdf
... hưởng đến c c ch c năng c a c c ch c năng c a c c cổng A và B. Hình 5.3.Dạng từ điều khiển đối với Mode I/O c a IC 82 55A. chương 18: GIAO TIẾP VỚI VI MẠCH 82 53 VỚI C C NGOẠI VI VÀ CPU Trong ... C p xung Clock cho thiết bị nhận với m c t c động, ho c t c động lên sườn lên, ho c t c động sườn xuống c a xung Clock nhờ vào SW chuyển mạch. C p xung Clock cho vi mạch 82 51 để th c hiện đồng ... với c c ngoại vi thông qua c c c ng A, B và C. Đối với hệ thống này, chọ 82 55A làm vi c ở Mode 0 là thích hợp nhất. C c đ c diểm I/O ở m c 0 như sau: 1. C c ngõ ra đư c chốt (Latch). 2. C c...
Ngày tải lên: 21/01/2014, 20:20
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
... AAAGACACG (P8), and AAAGACAT A (P9), and their complementary sequences CATGTCTCT (P 2C) , CATGTCCTT (P 3C) , CATGTATTT (P 4C) , CATGGCTTT (P 5C) , CATCTCTTT (P 6C) , CAGGTCTTT (P 7C) , CGTGTCTTT (P 8C) , and TATGTCTTT ... (5¢- ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢- CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢- ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), and Hi_Nterm R (5¢- CGGGATCCCGC TGCTGGTATCGCTCCTTTG-3¢), and cloned in pPRO- TET ... 5¢-GGGGCTTGATCTCAAAATGA-3¢. The caspase-10 gene-speci c primers were: forward, 5¢-GA CGCCTTGATGCTTTCTTC-3¢; reverse, 5¢-ATGAAGGC GTTAACCACAGG-3¢. PCR conditions for these two genes were similar, except...
Ngày tải lên: 07/03/2014, 10:20
LUẬN VĂN:THIẾT KẾ BỘ CHUYỂN ĐỔI SỐ - TƯƠNG TỰ 8 BÍT SỬ DỤNG CÔNG NGHỆ BÁN DẪN CMOS pdf
Ngày tải lên: 28/06/2014, 01:20
1500 Test C.pdf
... that he so far to seek. a. had come b. had been coming c. has come d. has been coming a 29. I tried the bus, but I missed it. a. catching b. to catch c. catch d. catch up >b 30. Women only ... am c. be d. have been > c 50. She often uses her goods as as she can. a. economic b. economically c. economical d. economicly 31. War stole his youth and his home. Everything in his life changed ... bone a 5. a. rate b. late c. private d. date c 6. a. chair b. cheap c. chemist d. child c 7. a. look b. book c. soon d. good c II. Find the mistake: 8. We can prevent flood by preservation...
Ngày tải lên: 05/08/2012, 12:27
Implementing an 8 bit Processor based Design in an FPGA
... Projects panel and select Save Project) in a new directory called 8- bit FPGA Processor. 3. Add a new schematic document to the FPGA project by selecting File » New » Schematic (or click on ... Devices view, click on the Live button and check that the Connected indicator is green. 3. In the Devices view, click on Compile. The red indicator will turn green when a successful compilation ... directory as the FPGA project and schematic files. 3. Create a new C file by right-clicking on the embedded project name in the Projects panel and selecting Add New to Project » C File , or click...
Ngày tải lên: 17/08/2012, 09:12
Bạn có muốn tìm thêm với từ khóa: