... remodelling/ resorption in arthritic diseases such as OA will help to bring new therapeutic strategies to clinical practice. For instance three factors, namely receptor activator of nuclear factor-κB ... doxycycline did not reduce the mean severity of joint pain. In contrast, doxycycline had no effect on either JSN or pain in the contralateral knee. This study showed that doxycycline can reduce the ... action of this cytokine can also be reduced by several means within the clinical context of OA. One compound is rhein, the active metabolite of diacerein, which inhibits IL-1 synthesis and activity.
Ngày tải lên: 09/08/2014, 07:20
... one of the two principal investigators If a given FMG decided to delay its acceptance or refusal to participate in the study, the research assistant or one of the principal investigators would contact ... pertaining to the implementation of this type of approach [15-17] One of the critical issues in this regard consists of recruiting participants [15] Indeed, recruiting and retaining physicians ... meeting) Intervention (the DECISION+ program) The intervention was based on a conceptual framework integrating the principles of SDM, including evidencebased medicine and patients’ involvement in
Ngày tải lên: 10/08/2014, 10:23
Comparative Analysis Of Accounting Information Systems Of The Netherlandsand Gungary In Order To Reveal The Possibilities Of Improvingthe Gungarian System
... understanding of the differences between the Dutch and the Hungarian accounting systems in theory and in practice, the dissertation revealed the main differences in the regulation of the financial accounting ... specific accounting rules and principles during the evaluation of income of agricultural holdings The accounting methods, specialities of the system and the contents of the annual report were introduced ... the input (Shadow price or marginal product In a production function, shadow price or marginal product of a factor is the increase in output due to a unit increase in the input of the factor;
Ngày tải lên: 10/12/2016, 22:59
Service quality and customer satisfaction in business to business the case of ready mix concrete industry vietnam
... obviously about the components of their service quality affecting satisfaction of their customers whereby they can improve their performance to increase the level of customer satisfaction Your information ... OF ECONOMICS HO CHI MINH CITY International School of Business Le Thi Binh Phuong SERVICE QUALITY AND CUSTOMER SATISFACTION IN BUSINESS -TO- BUSINESS: THE CASE OF READY-MIX CONCRETE ... validated instrument to measure the customer’s perceptions about the service being delivered is crucial, especially since there is evidence which show that the customer’s evaluation of service quality
Ngày tải lên: 04/06/2017, 21:24
Proposed policy solutions for improving the disaster early warning system in Vietnam to increase the efficiency of loss mitigation, prevention
... compared to 110 people died in Philippines (CCFSC) 2.3 Dissemination of warnings and the communication issue Warning needs quick delivery of information to those at risk of direct and indirect ... the incident - In respect of decision-making support system: To develop tools to support decision-making of concerned authorities to direct disaster prevention: Integration of historical information, ... Geophysics (VAST) Forecast Central Steering Committee on natural disasters prevention (CCFSC) Central Search and Rescue Commission (VINASACOM) Information alert and response Standing OfficeCCFSC and
Ngày tải lên: 03/02/2020, 13:55
Long-term effects of an inpatient weight-loss program in obese children and the role of genetic predisposition-rationale and design of the LOGIC-trial
... obtained from the children and their accompanying legal guardians The study is conducted according to the declaration of Helsinki (Seoul, 2008) and approved by the ethics committee of the Faculty ... which typically lasts for to weeks The duration of the stay depends on health insurance allowance and the severity of obesity Typically the children are referred to the clinic for weeks and in case ... with the aim to include a total of 1,500 participants by 2013 Figure shows the flow chart of the recruitment and the measurement process Table Inclusion and exclusion criteria for participation in
Ngày tải lên: 26/03/2020, 00:18
Service quality and customer satisfaction in business to business the case of ready mix concrete industry vietnam
... OF ECONOMICS HO CHI MINH CITY International School of Business Le Thi Binh Phuong SERVICE QUALITY AND CUSTOMER SATISFACTION IN BUSINESS -TO- BUSINESS: THE CASE OF READY-MIX CONCRETE ... newspaper in Holcim Vietnam Ready Mixed Concrete is also referred as the customized concrete products for commercial purpose The Ready-mix Concrete Company offer different concrete according to user's ... validated instrument to measure the customer’s perceptions about the service being delivered is crucial, especially since there is evidence which show that the customer’s evaluation of service quality
Ngày tải lên: 02/10/2020, 15:31
gm csf signalling blockade and chemotherapeutic agents act in concert to inhibit the function of myeloid derived suppressor cells in vitro
... pancreatic cancer patients, with the aim of limiting the MDSC differentiation occurring in response to chemotherapy-induced in? ??ammatory mechanisms Consequently, using this approach to overcome the ... to achieve targeted killing of tumour cells.7,8 The number of MDSC circulating in the blood correlates with the clinical stage of some breast and gastrointestinal cancers, with increased percentages ... microenvironment of human pancreatic cancer Cancer Res 2015; 75: 2629–2640 26 Wang Z, Liu Y, Zhang Y, Shang Y, Gao Q MDSC-decreasing chemotherapy increases the efficacy of cytokine-induced killer cell immunotherapy
Ngày tải lên: 04/12/2022, 10:35
Measures to promote the reform of administrative procedures in the operation of the public universities in vietnam (Sum)
... reform of administrative procedures: For Ministry of Education and Training, according to plan of administrative procedure reform of Ministry of Education and Training in the ... Originated from current status, the author has chosen the topic “Measures to promote the reform of administrative procedures in the operation of the public universities in vietnam” as the topic ... we are carrying out in accordance with resolution of the 4 th Congress of The Central Committee of the Communist Party of Vietnam term XI. Administrative procedures relate closely to operation
Ngày tải lên: 22/10/2014, 11:11
Tài liệu THE VALUE OF IMPROVED PUBLIC SERVICES: AN APPLICATION OF THE CHOICE EXPERIMENT METHOD TO ESTIMATE THE VALUE OF IMPROVED WASTEWATER TREATMENT INFRASTRUCTURE IN INDIA docx
... of coefficients 1 to n are attached to the vector of attributes ( Z ). In this specification, m is the number of household specific characteristics employed to explain the choice of the ... by including interactions of household characteristics with choice specific attributes in the utility function. When the interaction terms with household characteristics are included, the indirect ... treatment programme alternative, and the vector of coefficients 1 to l are attached to the vector of interaction terms ( S ) that influence utility. Since household characteristics are constant...
Ngày tải lên: 18/02/2014, 01:20
Tài liệu Efforts to Improve the Quality of Vocational Education in Secondary Schools docx
... measure of the intensity of each school’s vocational pro- gram. Finally, states were selected to include a wide range of values for a number of secondary characteristics, including geo- graphic location, ... offered specific guidance on the kinds of improvements that a program should incorporate to enhance its quality. These improvements included x integrating academics into vocational and technical ... secure the site’s participation in the study. In some cases, state officials elected to contact the sites to encourage them to participate. At the district level we requested interviews with the...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5Â-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3Â)(Nẳ A, T, G, C) and pyk- back (5Â-CTCTACATGCATTTCAACAATAGGGCCTG TC-3Â) for amplication of pyk. The resulting PCR prod- ucts, containing synthetic promoters ... Plasmid complements of Streptococ- cus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J Bacteriol 154, 1–9. 21 Brøndsted L & Hammer K (1999) Use of the integra- tion ... (1998) Transcriptional activation of the glycolytic las operon and catabolite repression of the gal operon in Lactococcus lactis are mediated by the catabo- lite control protein CcpA. Mol Microbiol...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Cyclic ADP-ribose requires CD38 to regulate the release of ATP in visceral smooth muscle ppt
... other words, the presence of CD38 is mandatory for the occurrence of intracellular actions of extracellu- lar cADPR. Low concentrations of cADPR, which do not produce measurable changes in mechanical ... prejunction- al P2 receptors were not involved in the facilitating effects of cADPR. In contrast, the inhibitors of intra- cellular cADPR receptors 8-Br-cADPR (80 lm) and ryanodine (50 lm for 45 min) ... the exogenous cADPR, or acetylcholine-induced produc- tion of cADPR [28]. Instead, the enhancing effect of cADPR on the spontaneous release of ATP is inhibited by 8-Br-cADPR, a speci c antagonist of cADPR...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo khoa học: Concepts and tools to exploit the potential of bacterial inclusion bodies in protein science and biotechnology pdf
... microscop- ies, including fluorescence microscopy, is of the order of 0.1 lm (in the image X, Y plane) due to the diffrac- tion limit of the employed light. Even in laser scanning confocal microscopy, ... pro- teins in the E. coli cytoplasm (Fig. 1A). Stress conditions, however, cause the impairment of the cellular quality control system, thus inducing mis- folded proteins to accumulate in the cytoplasm ... expres- sion of recombinant proteins in the cytoplasm of Escherichia coli. Microb Cell Fact 4,1. 36 de Marco A, Deuerling E, Mogk A, Tomoyasu T & Bukau B (2007) Chaperone-based procedure to increase yields...
Ngày tải lên: 06/03/2014, 00:20