... science of the “beautiful” in a work of art The aesthetic appeal of a work of art is defined by the visual Social, ethical moral, and contemporary standards of a society armature A structure of wood ... Compare the "god-like" qualities of a particular character (such as Diana, goddess of the hunt) to a modern character (such as Mia Hamm, huntress of a soccer goal) The Huntington Library, Art ... in a kiln it is called bisque ware At this stage, the clay has changed composition and can no longer have water added to it and turned back into useable material bronze An alloy of copper and...
Ngày tải lên: 19/02/2014, 10:20
... six PA-N-glycan fractions were identified as GlcNAcMan3GlcNAc2-PA (GNb), Man2Man3GlcNAc2-PA (M5), GlcNAc2Man3 GlcNAc2-PA (GN2), Man3Man3GlcNAc2-PA (M6), Man4Man3GlcNAc2-PA (M7) and Man5Man3GlcNAc2-PA ... cellular toxicity J Biol Chem 277, 26733– 26740 Shinkawa T, Nakamura K, Yamane N, Shoji-Hosaka E, Kanda Y, Sakurada M, Uchida K, Anazawa H, Satoh M, Yamasaki M et al (2003) The absence of fucose ... and reacted with biotinylated AAL (Seikagakukogyo, Tokyo, Japan) at a concentration of lgÆmL)1 or concanavalin A (Seikagakukogyo) at a concentration of 0.3 lgÆmL)1 at room temperature for h After...
Ngày tải lên: 23/03/2014, 04:20
Báo cáo toán học: "Maximum Multiplicity of a Root of the Matching Polynomial of a Tree and Minimum Path Cover" pdf
... journal of combinatorics 16 (2009), #R81 For any root θ of µ(G, x), it was shown by Neumaier [6, Corollary 3.3] that the analogue of Gallai’s Lemma holds when G is a tree A different proof was given ... the idea of the proof of Theorem 5.3 in [3], we shall prove the Stability Lemma for trees with any given root of its matching poynomial Note that the Stability Lemma is a weaker statement than Theorem ... Theorem 1.2 If G has a Hamiltonian path, then all roots of its matching polynomial are simple The above is the source of motivation for our work It is natural to ask when does equality holds in...
Ngày tải lên: 07/08/2014, 21:21
ACCESS TO CREDIT OF ANIMAL PRODUCTION HOUSEHOLDS: A STUDY IN HAI DUONG PROVINCE, VIETNAM
... statistics and analysis of variance (ANOVA) F- test was used for mean comparison Animal production refers to poultry, breeding and fattening pig, and fish production 1051 Access to credit of animal production ... level of household head, dependency ratio, area of crop land, area of fish pond, and number of poultry and pigs The result of F-test showed that dependency ratio, area of crop land, area of fish ... educational level and area of fish pond were key affecting factors 3.5 Strengths and weaknesses of the formal sector in Hai Duong - An assessment of animal production households Lack of access...
Ngày tải lên: 28/08/2013, 09:18
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx
... the organic fraction of soil, including wastewater pollutants, plant roots, animal and plant residues, and microbial biomass OM influences the chemical and physical properties of soils even at the ... water quality data was monitored since 2003 until to 2006 The data showed that constructed subsurface flow wetland removes pollutants significantly and satisfy Vietnamese standards for wastewater ... 2007 Chiang Mai, Thailand ================================================================================ In analysis, data were compared graphically and by an ANOVA analysis at the significant...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt
... GTT GGA ATT CCA TCA TCA TCA TCA TCA TCA GGG CAC GAC ACA CAT CCC C; and reverse primer, GAT CGG TAC CTC ATT ACA GAG GAG GGA TAT GGG GAA C The PCR reaction was done as described above The amplified ... AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT GGT GGT GGT GGT GCA GAG GAG GGA TAT GGG GAA CGG CAA A The PCR reaction was done ... (1983) Production of heat-resistant polyphenol oxidase, Japanese patent 61115488 Yamada Y, Tawara Y & Yoshika H (1983) Production of heat-resistant polyphenol oxidase, Japanese patent 60062980 Abdel-Raheem...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot
... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... PRMT reaction, the use of SAM analogs is a logical strategy for the direct inhibition of PRMTs As a SAM analog, sinefungin can compete for SAM binding and inhibit the activity of all SAM-dependent ... Bonham et al 11 Clarke SG (2006) Inhibition of mammalian protein methyltransferases by 5¢-methylthioadenosine (MTA): a mechanism of action of dietary SAMe? In The Enzymes: Protein Methyltransferases...
Ngày tải lên: 06/03/2014, 11:20
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf
... vulnerable value in Africa P van der Zaag – July 2006 23 Human appropriation of natural capital: Comparing ecological footprint and water footprint analysis A. Y Hoekstra – July 2007 24 A river basin ... Zambezi basin A. Y Hoekstra, H.H.G Savenije and A. K Chapagain − March 2000 The water value-flow concept I.M Seyam and A. Y Hoekstra − December 2000 The value of irrigation water in Nyanyadzi smallholder ... irrigation scheme, Zimbabwe G.T Pazvakawambwa and P van der Zaag – January 2001 The economic valuation of water: Principles and methods J.I Agudelo – August 2001 The economic valuation of water...
Ngày tải lên: 06/03/2014, 21:20
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... xylosoxydans ssp xylosoxydans A- 6 N-acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N-acyl–D-amino acid amidohydrolase; V paradoxus Iso1: Variovorax paradoxus ... D-Aminoacylase European Patent 60,950,706 ,A2 22 Kubo, K., Ishikara, T & Fukagawa, Y (1980) Deacetylation of PS-5, a new beta-lactam compound II Separation and purification of L-amino acid acylase ... Therefore, according to all above analysis results, the strain Iso1 was clearly a strain of V paradoxus Cloning and nucleotide sequencing analysis of the N -D-AAase from V paradoxus Iso1 A V paradoxus...
Ngày tải lên: 08/03/2014, 16:20
A White Paper Describing Produced Water from Production of Crude Oil, Natural Gas, and Coal Bed Methane pot
... 30,641 No data available 29,768 6,943 No data available 78,530 No data available 50,857 No data available 162,739 No data available 1,596 No data available 867,122 40,792 No data available 3,555 ... Production by State (1,000 bbl) State Alabama Alaska Arizona Arkansas California Colorado Florida Illinois Indiana Kansas Kentucky Louisiana Michigan Mississippi Missouri Montana Nebraska Nevada New Mexico ... 388,661 No data available 1,282,933 No data available 999,143 90,754 1,346,675 76,440 318,666 No data available 223,558 164,688 No data available 445,265 No data available 59,503 No data available 3,103,433...
Ngày tải lên: 09/03/2014, 01:20
BÁO CÁO " ACCESS TO CREDIT OF ANIMAL PRODUCTION HOUSEHOLDS: A STUDY IN HAI DUONG PROVINCE, VIETNAM " potx
... statistics and analysis of variance (ANOVA) F- test was used for mean comparison Animal production refers to poultry, breeding and fattening pig, and fish production 1051 Access to credit of animal production ... level of household head, dependency ratio, area of crop land, area of fish pond, and number of poultry and pigs The result of F-test showed that dependency ratio, area of crop land, area of fish ... educational level and area of fish pond were key affecting factors 3.5 Strengths and weaknesses of the formal sector in Hai Duong - An assessment of animal production households Lack of access...
Ngày tải lên: 10/03/2014, 13:20
The Production of Child Health in Kenya: A Structural Model of Birth Weight potx
... similarly high rates of tetanus vaccination in low-income countries Dow et al.(1999) report tetanus vaccination rates of the same orders of magnitude for Malawi, Tanzania, Zambia and Zimbabwe ... holding Panels 2D and 2E show sample means for one environmental variable: long-term annual rainfall and its interactions with cattle and land These variables are used to capture effects of natural ... demographics Focusing on the IV estimates, it can be seen that the birth weight of babies in rural areas is lower than that of urban babies, and that male infants are heavier than female infants.5...
Ngày tải lên: 14/03/2014, 09:20
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
... CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCGGGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences) In order to introduce an ... 2-amino-3-oxobutyrate, which spontaneously decarboxylates to aminoacetone and CO2, or is cleaved in a CoA-dependent reaction by 2-amino-3-ketobutyrate coenzyme A lyase to glycine and acetyl-CoA Aminoacetone can ... Journal 273 (2006) 2722–2729 ª 2006 The Authors Journal compilation ª 2006 FEBS R Machielsen and J van der Oost 14 Higashi N, Matsuura T, Nakagawa A & Ishikawa K (2005) Crystallization and preliminary...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt
... (5¢-GTCGTCTTGCGGTCACCT GGACATGCATCAACGAACAG-3¢) and Ct-Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA GTCTCAAGTC-3¢) These primers contained BstEII and BamHI sites and were used to generate a fragment that ... antigens Diagnosis Aspf1 D(7–22) vs Aspf 1a a-sarcin vs Aspf 1a a-sarcin D(7–22) vs Aspf 1a a-sarcin D(7–22) vs a- sarcina Asthma Cystic fibrosis ABPA 33 50 20 33 30 33 50 89 70 20 33 22 a Data calculated ... developed with an anti-Aspf1polyclonal antiserum (Fig 2B) The amino acid compositions of 2537 ´-Ortega et al L Garcia Variants of the A fumigatus allergen Aspf1 Fig SDS ⁄ PAGE analysis (A) Coomassie blue...
Ngày tải lên: 16/03/2014, 19:20
Commons-based Peer-Production of Physical Goods Is there Room for a Hybrid Innovation Ecology? pdf
... of examples of Fab Lab projects Mikhak et al (2002) report on projects in India, at Vigyan Ashram Fab Lab just outside the village of Pabal in Maharashtra, and at the Costa Rica Institute of Technology ... study of actual users of Fab Labs Such a study based on participant observation and other methods should be able to clarify attitudes and behaviour of Fab Lab users as important stakeholders of a ... http://www.monochrom.at/hacking-the-spaces/, accessed 30 August 2010 Hackerspaces (2010) HackerspaceWiki Available online at http://hackerspaces.org/wiki/, accessed 30 August 2010 Hackerspaces (201 0a) List of Hackerspaces Available...
Ngày tải lên: 23/03/2014, 10:20
Production of transgenic deepwater indica rice plants expressing a synthetic Bacillus thuringiensis cryIA(b) gene with enhanced resistance to yellow stem borer docx
... proportion of dead larvae to applied larvae (%) Missing larvae were grouped within the mortality category (i.e as dead larvae) 2.4 Protein extraction and immunoblot analysis Results and discussion About ... M.J Adang, R.E Lynch, W.F Anderson, A Wang, G Cardineau, P Ozias-akins, Expressing of a Bacillus thuringiensis cryIA(c) gene in transgenic peanut plants and its efficiency against lesser corn stalk ... of transgenic rice (Oryza sati 6a) plants from agronomically important indica and japonica varieties via electric discharge particle acceleration of exogenous DNA into immature zygotic embryos,...
Ngày tải lên: 23/03/2014, 22:20
Adoption and Impacts of Improved Maize Production Technology: A Case Study of the Ghana Grains Development Project pot
... Coastal savannah Coastal savannah Eastern Suhum Kraboa Yilo Krobo West Akim Fanteakwa Forest Transition Forest Forest Greater Accra Tema Coastal savannah Volta Adidome Jasikan Coastal savannah ... authors Table Location of survey districts Region District Ecological zone Upper West Wa Guinea savannah Northern Salaga Damongo Walewale Guinea savannah Guinea savannah Guinea savannah Brong Ahafo ... Ghana Grains Development Project Name Aburotia Dobidi Kawanzie Golden Crystal Safita-2 Okomasa Abeleehi Dorke SR Obatanpa Mamaba b Dadaba b Cidaba b Year of release Grain color Grain texture Maturity...
Ngày tải lên: 24/03/2014, 05:20
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... Louveau et al a T7 UG an as sa ana 84B1 A th um tabac N ana thali a ian hal t va A ati s 4F1 1O GT T U SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A ... ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers ... 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A t T79 UG na B C1 thalia T89 UG 9B1 A UGT8 9A1 P A thaliana M T7 UG 0.1 UGT8 a lian tha C...
Ngày tải lên: 28/03/2014, 23:20
A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL – A technological, economic and ecological investigation based on case studies pot
... administration First, responses automatically went into a database that was available for analysis at all times This allowed for monitoring of survey progress and eliminated the time and cost associated ... identification (name of the company, address, name of individual, professional position) The main page stated the regulations of data privacy88, further information about the report as well as a link to ... instantly saved the results to the connected database thus eliminating the need for data entry Administration of the questionnaire online offered several advantages over a paperand-pencil administration...
Ngày tải lên: 29/03/2014, 17:20
Analysis and practical implementation of a model for combined growth and metabolite production of lactic acid bacteria
... accuracy of latter input values is also of major importance Therefore, an adequate calculation method for the actual values of [LaH] and pH at each time point during growth is necessary According ... and derivatisation of the lactic acid present in the filtrate with methanol, lactic acid was measured through gas chromatographic analysis of the methyl ester (separation with a Delsi GC on a ... related to the total amount of lactic acid LaHtot and the pH by the lactic acid chemical equilibrium As explained above, the approach of Nicolaı et al is based ¨ on these chemical principles and...
Ngày tải lên: 05/05/2014, 08:44