... or the difference between K2 and K1, and the reduction in band width Within the eight tested solvents systems, the differences between K2 and K3, and between K4 and K5 in solvent systems (petroleum ... (2H, m, Hb-2 and Hb-6 ) and 2.00 (2H, m, Hb-3 and Hb-5 ) The 13C NMR spectrum of compound displayed signals at d: 22.8 (C-3 and C-5), 27.5 (C-7), 28.8 (C-9 and C-10), 31.5 (C-2 and C-6), 32.9 ... not be separated from each other by CCC Since K2 and K4 were close to K3 and K5, respectively, curcumol (2) and germacrone (3), and curzerene (4) and 1,8-cineole (5) were hardly separated from...
Ngày tải lên: 07/03/2014, 21:20
... methanol production (8%) and in the chemical and metallurgical industries (4%) With greater emphasis placed on environmental sustainability, energy cost and security (both for stationary and transport ... dense phase metal and porous ceramic membranes, and compare their separation properties and performance in membrane reactor systems in particular for natural gas reforming and the water gas shift ... offering a cleaner environment 1.2 H2 production and purification needs In thermochemical processes for hydrogen production from fossil fuels, separation and purification is a critical technology...
Ngày tải lên: 13/05/2014, 01:01
Báo cáo y học: " Production and purification of VP2 protein of porcine parvovirus expressed in an insectbaculovirus cell system" docx
... contributions GY and HZ carried out the molecular studies, and drafted the manuscript SC participated in the design of the study and conceived of the study, and participated in its design and coordination ... (TATGGATCCGATGAGTCATCATCACCATCACCATAGTGAAAATGTGGAACAAC) and PPV-VP2 RV (GCGT CGACTATGAGTTAGAGTTTGTATTAG) The underlined nucleotides represent BamHI and SalI restriction sites, respectively The PCR products were digested with BamHI and SalI and ... VLPs of infectious bursal disease virus [19], and parvoviruses including PPV [14] and B19 [15] To further facilitate the use of PPV VP2 for diagnosis and vaccination, the goal of the current study...
Ngày tải lên: 11/08/2014, 21:21
Báo cáo khoa học: "Production and purification of immunologically active core protein p24 from HIV-1 fused to ricin toxin B subunit in E. coli" ppt
... translation products from sequences RTB/p24 and p24 was 57 kDa and 34 kDa respectively E coli expression of RTB/p24 and p24 proteins Purification of RTB/p24 and p24 was performed from cell lysates ... antibodies and the 57 kDa band was again detected (Figure 5, lanes to 5) The anti-ricin antibodies also detected other minor bands visible in the non-retained and wash fractions (Figure 5, lanes and ... recombinant proteins expressed in E coli and immunodetection Purification Purification of recombinant proteins expressed in E coli and immunodetection Purification was performed as described in...
Ngày tải lên: 12/08/2014, 04:21
“Aggregating production cost and evaluating unit cost in Huong Giang construction company”.
... between production costs and unit cost Production costs and unit cost are two different terms of production process Production costs reflect the moneytary value that company cost in process and unit ... issues as follows: • Concept of production costs and unit cost, classification and relationship between production costs and unit cost • The tenor of aggregating production costs • Estimation of ... accounting and auditing 26 Graduation thesis Aggregating production costs and evaluating unit cost Handing over finished works Making balance sheet of finished works Contract closing 1.2.2 Production and...
Ngày tải lên: 08/08/2013, 14:22
Isolation and characterization of an extracellular polymer closely related to flocculation of activated sludge
... H and Kadowaki, K (1985a) Flocculant production by Paecilomyces sp Taxonomic studies and culture conditions for production Agric Biol Chem., Vol.49, No.11, 3151-3157 - 299 - Journal of Water and ... kaolin clay and activated charcoal flocculated satisfactorily (the flocculation values at pH 2.5 of kaolin clay and activated charcoal were 79.6% and 67.1%, respectively) On the other hand, in the ... Significance and behavior of heavy metals in waste water treatment process Ⅰ Sewage treatment and effluent discharge Sci Total Environ., Vol.30, 1-44 Lowry, O Hosenbrough, N J., Farr, A L and Randall,...
Ngày tải lên: 05/09/2013, 09:08
Tài liệu PRODUCTION PROCESSES AND EQUIPMENT P1 pdf
... 20:1 to 80:1 Oils Chemicals and synthetics Air At low cutting speeds (40 ft/min and below), oils are highly recommended, especially in tapping, reaming, and gear and thread machining Cutting ... brass and bronze In aluminum alloys, additions up to 1-3% of zinc and magnesium improve their machinability Cutting Speeds and Feeds 354 Cutting speed is expressed in feet per minute (m/sec) and ... (ASM) Handbook;3 American Machinist's Handbook;4 Machinery's Handbook;5 American Society of Mechanical Engineering (ASME) publications; Society of Automotive Engineers (SAE) Publications; and International...
Ngày tải lên: 17/12/2013, 14:15
Tài liệu PRODUCTION PROCESSES AND EQUIPMENT P2 ppt
... achieved by band-friction cutting blades with a surface speed up to 15,000 fpm Other band tools include band filing, diamond bands, abrasive bands, spiral bands, and specialpurpose bands 33.14 ... Water, soluble oil and water, and weak solutions of sodium silicate in water are used In turning and milling plastics, diamond tools provide the best accuracy, surface finish, and uniformity of ... Grinding and abrasive machines include Surface grinders, reciprocating or rotating table Cylindrical grinders, work between centers, centerless, crankshaft, thread and gear form work, and internal and...
Ngày tải lên: 17/12/2013, 14:15
CHAPTER 9: Production Costs and Business Decisions
... total product and average product both fall (and marginal product is negative) Chapter Production Costs and Business Decisions 11 Price and Marginal Cost: Producing to Maximize Profits Production ... production in order to produce various goods and services Although there are thousands of different factors of production, or inputs, Chapter Production Costs and Business Decisions 10 for simplicity ... costs and benefits determine how many units will be produced and consumed up to the intersection of the marginal cost and demand (marginal benefit) curves, the marginal benefit of each Chapter Production...
Ngày tải lên: 17/12/2013, 15:19
Tài liệu Production Planning and Scheduling Using Genetic Algorithms doc
... random and inserts it in a random position Displacement mutation selects a substring at random and inserts it in a random position Reciprocal exchange mutation selects two positions at random and ... weight and processing time For given two jobs i and j, there are four basic patterns of ordering relations of them wi Ն wj and pi Ն pj wi Ն wj and pi Ͻ pj wi Ͻ wj and pi Ն pj wi Ͻ wj and pi Ͻ ... simple example of three machines and nine jobs In this example, jobs 2, 3, and are processed by machine 1, jobs and are processed by machine 2, and jobs 1, 4, 5, and are processed by machine ©2001...
Ngày tải lên: 25/12/2013, 19:15
Tài liệu 44 Speech Production Models and Their Digital Implementations ppt
... Tgv Ug , and the pressure at the velum is Pv = Zv Uv Once Pv and Uv are known, the volume velocity and/ or pressure at the nostrils and lips can be computed by inverting the matrices Kvn and Kvt ... observed phenomenon that the fricatives th and f (and the corresponding voiced dh and v) are weak compared to the fricatives s and sh The teeth (upper for s and lower for sh) provide the obstacle ... Speech Production Models and Their Digital Implementations 44.1 Introduction Speech Sounds • Speech Displays 44.2 Geometry of the Vocal and Nasal Tracts 44.3 Acoustical Properties of the Vocal and...
Ngày tải lên: 22/01/2014, 12:20
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... wholecell extracts and the supernatant and precipitate fractions are shown in Fig It was found that E coli BL21(DE3) ⁄ pHYDJs and E coli BL21(DE3) ⁄ pHYDPf produced a predominant band with an apparent ... purified proteins; M, molecular weight standards For the molecular weight standards, the bands from top to bottom correspond to 116.0, 66.2, 45.0, 35.0, 25.0 and 18.4 kDa, respectively consistent ... SGL2 and SGL3, correspond to residues 60–71, 91–99 and 151–161, respectively On the basis of the homology model, the SGLs of HYDJs and HYDBp (PDB accession number 1NFG) were superimposed and compared...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx
... (types A+, B+ and O+), rabbit and horse where they showed blood group specificity and distinct hemagglutination activity P I and P II promoted hemagglutination of human erythrocytes at 22.5 and 27.5 ... isolated, and their amino acids sequences deduced by cDNA cloning and verified by MS Half maximal inhibitory concentration (IC50) and median lethal dose (LD50) values from HeLa cells and mice divided ... numerals I, II, III and IV and refers to each pulchellin Characterization of four pulchellin isoforms isoform (P I, P II, P II and P IV) The A-chain of P II was formerly cloned and named recombinant...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... these cells Mesenteric BECs and LECs (Fig 5A,B) were also obtained by the same strategy as illustrated in Figs and 4, and were treated with VEGF-A or VEGF-C (Fig 5C) MAPK and Akt phosphorylation ... induced in both BECs and LECs by stimulation with VEGF-A or VEGF-C, indicating that the cultured ECs responded to the endothelial growth factors Isolation and characterization of BECs and LECs We next ... introduced by lipofection and maintained for at least days after transfection as assessed by GFP expression (Fig 4E) These Fig Isolation and characterization of uterine BECs and LECs expressing tsA58T...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx
... curves Squares and dotted line: data and fitting with PHI/PHO ratio of 0.5 Triangles and continuous line: data and fitting with PHI/PHO ratio of Asterisks and broken line: data and fitting with ... nmÆmin)1, band-width of 1.0 nm, and a resolution of 0.1 nm in the temperature range between 10 °C and 70 °C, after preincubation for 10 at each temperature Three runs were accumulated and averaged ... 12768–12785 Pulver, S.C., Froland, W.A., Lipscomb, J.D & Solomon, E.I (1997) Ligand field circular dichroism and magnetic circular dichroism studies of component B and substrate binding to the...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: The isolation and characterization of cytochrome c nitrite reductase subunits (NrfA and NrfH) from Desulfovibrio desulfuricans ATCC 27774 Re-evaluation of the spectroscopic data and redox properties ppt
... column, equilibrated and eluted in 0.1 M Tris/HCl, pH 7.6 and several common protein–protein dissociation salts (1 M sodium chloride, M urea and M guanidinium chloride) and ionic detergents (CHAPS, ... intense band of 61 kDa (NrfA) and a band of weak intensity of 19 kDa (NrfH), confirming its hetero-oligomeric nature (Fig 1, lane 1) However, in the absence of boiling (Fig 1A, lanes and 4) high ... and 4) high molecular mass bands of approximately 110 kDa and > 200 kDa were visible, as well as a faint band at 37 kDa, suggesting the presence of dimers All of the bands stained positively for...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu recent trends in the law and policy of bioenergy production promotion and use docx
Ngày tải lên: 21/02/2014, 05:20
Tài liệu NATURAL ENDOWMENTS, PRODUCTION TECHNOLOGIES AND THE QUALITY OF WINES IN BORDEAUX. IS IT POSSIBLE TO PRODUCE WINE ON PAVED ROADS? pot
... gravel-sandy and sandy Some soils are better than others and deep gravel beds (like in Pauillac) seem to be the best, though there are outstanding wines produced in the much poorer gravel-sandy ... the landscape, to the architecture of the villages and to any other element that belongs to the region of production. " Thus terroir includes event the landscape, as if it affected the quality and ... collected during the winter and spring of 19901991 by Andras and Muriel Monzak who conducted interviews in 102 châteaux Each château was visited, and a questionnaire was handed out with some thirty...
Ngày tải lên: 22/02/2014, 09:20
NOTES ON THE ROLE OF EDUCATION IN PRODUCTION FUNCTIONS AND GROWTH ACCOUNTING pot
... Foundation Grants Nos GS 712 and OS 2026X I am indebted to C A Anderson, Mary Jean Bowman, E F Denison, R J Gordon, and T W Schultz for comments and suggestions 71 72 EDUCATION AND PRODUCTION FUNCTIONS ... is broken down into the 5—7 and (5—6 and 7—8 for 1940, 1948, and 1952) on the basis of data provided in Current Population Report, and and the first part of 1952, 5—7 and thereafter — 24.6 8.3 ... Income and Wealth, 14 (3), 1964, 217—46 13 Brown, M., and A Conrad, "The Influence of Research and Education on CES Production Relations," in M Brown, ed., The Theory and Empirical Analysis of Production, ...
Ngày tải lên: 06/03/2014, 21:20