processing text input with a character array

... java.lang.Object java.lang.Runnable (interface) java.lang.Runtime java.lang.String java.lang.StringBuffer java.lang.System java.lang.Thread java.lang.Throwable Data Type Classes java.lang.Boolean ... java.lang.Byte java.lang .Character java.lang.Integer java.lang.Long java.lang.Short Collection Classes java.util.Enumeration (interface) java.util.Hashtable java.util.Stack java.util.Vector Input/ output ... java.io.DataInputStream java.io.DataOutput (interface) java.io.DataOutputStream java.io.InputStream java.io.InputStreamReader java.io.OutputStream java.io.OutputStreamWriter java.io.PrintStream java.io.Reader java.io.Writer...

Ngày tải lên: 12/08/2014, 11:20

... desk a the b a c an d some > c 134 What is color of your pen? a the b a c an d any > a 135 Kate and Mary are going to cinema a the b a c an d no article > a 136 My parents are always at ... are tall a the b a c an d no article > d 54 Hoa is good pupil a the b a c an d no article > b 55 That is a bag It is on table a the b a c an d no article > a 56 We are in same class ... has been demand for computers this year than last year a few b little c fewer d more > d 290 Always make sure your luggage has on it when you travel a a card b a cartel c a label d a traveling-bag...

Ngày tải lên: 05/11/2012, 09:18

... initial phase was maintained longer than in the absence of LlCBP3 3A, indicating that LlCBP3 3A acts synergistically with LlChi1 8A However, the effect of LlCBP3 3A was small and ceased after approximately ... 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and annealed to a prepared expression vector (pET30 Xa LIC) provided ... containing a putative transcription regulator (GenBank ID: AAK06047.1), chitinase gene (GenBank ID: AAK06048.1) and gene encoding a family 33 CBP (GenBank ID: AAK06049.1) was amplied FEBS Journal...

Ngày tải lên: 18/02/2014, 08:20

... distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and human are available and revealed ... a high-resolution solution structure of the C-terminal a- domain has become available The data revealed a tertiary fold very similar to that of MT-1 and MT-2, except for a loop that contains an ... (Tubingen, Germany), and all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a- and b- domains The individual a- and b-domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA and MDPNCSCSTGGSCTCT...

Ngày tải lên: 07/03/2014, 09:20

... dissociation rate constant at an insignificant change in the association rate constant (Fig 4, D2 and D1, respectively) Also, at pH 8.5, the rebinding study reveals an increase in the association and ... The authors thank Anna V Chistyakova and Dr Nona V Konovalova for preparing protein solutions This work was supported by the Belarusian Republican Foundation for Fundamental Research (Grant B00-176) ... R, Khan I, Juczszak L, Wang J, Manjula B, Acharya SA, Bonaventura C & Friedman JM (2004) Domain-specific effector interactions within the central cavity of human adult hemoglobin in solution and...

Ngày tải lên: 16/03/2014, 14:20

... ssDNA bead to be loaded into a well • Enzyme beads and packing beads are added Enzyme beads containing sulfurase and luciferase, and packing beads used only to keep the DNA beads in place • Above ... Preparation of the DNA • DNA is fragmented by nebulization • The DNA strand’s ends are made blunt with appropriate enzymes • A and “B” adapters are ligated to the blunt ends using DNA ligase ... and the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A magnetic field filters all DNA rich beads from empty beads, and then extracts...

Ngày tải lên: 19/03/2014, 22:32

... flax leaves Galactolipids were separated and purified as described in Materials and methods EDE content was measured by UV absorbance of MGDG and DGDG fractions at 267 nm Average values and standard ... galactolipid molecular species from flax leaves Total galactolipids were extracted from flax leaves, separated and purified as described in Materials and methods UV chromatograms (267 nm) of galactolipids ... extracted from: (A) unstressed plants, (B) infected plants (at h after inoculation with E carotovora atroseptica), (C) infected plants (at 24 h after inoculation with E carotovora atroseptica)...

Ngày tải lên: 23/03/2014, 05:22

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains...

Ngày tải lên: 23/03/2014, 07:20

... sodium and potassium alkali metal and various di- and tri-alkali metal adducts if standard solvents with 0.1% formic acid were used for the UPLC separation (Fig 2A) In addition, the alkali metal adducts ... and a corresponding amino acid sequence AVSAPTATPASPAGKKTVR All three N-terminal peptides were acetylated at the N-terminal amino acid, and the signal intensity decreased with lower molecular masses ... masslynx version 4.1 (Waters Corporation) With standard solvents, a capillary voltage of 3000 V and a cone voltage of 45 V was used With neutral solvents, a capillary voltage of 3500 V and a...

Ngày tải lên: 30/03/2014, 02:20

... phylogenetic analysis Enzyme Species GenBank/EBI A transferase A transferase A transferase A (cis A/ B) transferase A- likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA Amplification was performed using the Advantage Polymerase (Clontech) with initial denaturation at 94 °C min, followed ... fucosyllactose as acceptor However, cell extracts from the double transfectants showed a high N-acetylgalactosaminyltransferase activity and a weak galactosyltransferase activity These results indicate that...

Ngày tải lên: 31/03/2014, 09:20

... vectors and Dual LuciferaseÒ Reporter Assay System were obtained from Promega Corporation, Madison, WI, USA Taq DNA polymerase, T4 DNA ligase and calf intestinal alkaline phosphatase were obtained from ... luciferase activity was assayed and results are expressed as mean relative luciferase activity, in arbritary units (RLU) ± SEM (n ¼ 6) (D) As a complementary approach, total RNA was isolated from HEL ... prostaglandin and leukotriene synthesis in glomerular immune injury J Laboratory Clin Med 134, 478–482 Ushikubi, F., Aiba, Y., Nakamura, K., Namba, T., Hirata, M., Mazda, O., Katsura, Y & Narumiya,...

Ngày tải lên: 31/03/2014, 09:20

... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC 726,713 ... canus fam EcoRI BamHI (1809) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG pK9 Pol I EB (1816) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG...

Ngày tải lên: 18/06/2014, 18:20

... TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG Consensus (1851) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG ... Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC 726,713 ... canus fam EcoRI BamHI (1809) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG pK9 Pol I EB (1816) TGTTTCGGCGACAGGCAGACAGACGACAGGCAGACGTAAAAGACAGCCGGTCCGTCCGTCGCTCGCCTTAGAGATGTGGGCCTCTGGGCGCGGGTGGGGTTCCGGGCTTGACCGCGCGGCCGAGCCGG...

Ngày tải lên: 20/06/2014, 01:20

... desk a the b a c an d some > c 134 What is color of your pen? a the b a c an d any > a 135 Kate and Mary are going to cinema a the b a c an d no article > a 136 My parents are always at ... the b a c an d no article > b 55 That is a bag It is on table a the b a c an d no article > a 56 We are in same class a the b a c an d no article > a 57 Your book is the desk a at b over ... father a than b as c but d and > a 48 I am teacher a the b a c an d no article > b 49 My uncle is good engineer a the b a c an d no article > b 50 That is eraser a the b a c an d no article...

Ngày tải lên: 26/07/2014, 10:20

... straightforward, but given a parking function, finding the associate factorization is not obvious The proof below gives an algorithm for associating a factorization to any parking function In particular ... from some factorization (a1 b1 ) (an bn ), then bn = an + as we just saw But (a1 , , an−1 ) is a non-decreasing parking function of length n − Since a1 , , an−1 ≤ an , relabeling an + 2, ... again an action of Sn on factorizations, similar to the one we had in the type A case, it relies on the fact that any product r1 r2 of reflections with labels i1 , i2 can be written uniquely as...

Ngày tải lên: 07/08/2014, 06:23

... samples Characteristics of the patients are shown in Tables 1, and Bronchoalveolar lavage fluid (BALF) Bronchoalveolar lavage was performed under local anesthesia to a representative lung segment with ... between two and more than two variables was assessed with Mann-Whitney U and Kruskal Wallis test, respectively Data was calculated as mean from at least two concurrent samples of several tissue ... disturbed Page 11 of 13 Additional material Additional file 1: Table S1 Detailed data of the morphometrical analysis of Hba and Hbb positive area (sum of the bronchial/alveolar epithelium and interstitium;...

Ngày tải lên: 12/08/2014, 11:22

... Structure of parvistemonine (1) The source of Stemona alkaloids are the Stemona plants, also known as Roxburghia They are found in South Asia, Malaysia and North Australia and are classified as subshrubs, ... groups and contains more than 25 species.6 This family of plants has a history of medicinal applications Stemona and Croomia plants are used in both Japanese and Chinese folk medicine to treat an array ... didehydrostemofoline and other Stemona alkaloids all show insecticidal activity against larvae.10 In another study, tuberostemonine was shown to act as a glutamate inhibitor at the neuromuscular junction of crayfish...

Ngày tải lên: 23/08/2015, 17:30

... multi-scale approach (Fig 1.2) that combines ab initio quantum mechanical calculations with molecular dynamics and thermodynamic analysis In particular, we use the GAUSSIAN [13] software together with ... solution and at the interface  Algorithms that make use of mathematical ‘strings’ [22] to calculate the energy barrier for crystallization in n-dimensional space 22  Algorithms that can calculate ... interface  Create algorithms that make use of mathematical ‘strings’ [22] to calculate the energy barrier for crystallization in n-dimensional space  Create algorithms that calculate the fraction...

Ngày tải lên: 10/09/2015, 09:11

... Mr Prasanta Sahani, Mr Sashi Bhusan Rout, Mr Satyananda Kar, Mr Satyananda Barik, Mr Rajeeb kumar Jena, Mr Narahari Mahanta, Mr Bijay Kumar Das, Mr Satyanarayan Bhuyan, Mr Manish Singh and other ... Mother- in-law (Mrs Golap Manjari Behera), Brothers (Dr Subrat Kumar Barik and Mr Ratikanta Barik), Sisters (Mrs Saroj Bala Barik, Mrs i ACKNOWLEDGEMENTS Bandana Mahakud and Mrs Sujata Biswal), Brother-in-laws ... Brother-in-laws (Mr Dibakar Barik, Mr Manoranjan Mahakud, Dr Ramesh Biswal and Mr Kharabela Behera), sister in laws (Mrs Tanaya Barik and Mrs Rebati Barik) and nephews (Sonu, Sanjib, Guddu, Tutu, Prachi,...

Ngày tải lên: 10/09/2015, 15:52