presenting the patient with a model of emotions

Báo cáo y học: "Primary osteosarcoma of the urinary bladder treated with external radiotherapy in a patient with a history of transitional cell carcinoma: a case report" pptx

Báo cáo y học: "Primary osteosarcoma of the urinary bladder treated with external radiotherapy in a patient with a history of transitional cell carcinoma: a case report" pptx

... this article as: Papandreou et al.: Primary osteosarcoma of the urinary bladder treated with external radiotherapy in a patient with a history of transitional cell carcinoma: a case report Journal ... review of the literature Arch Pathol Lab Med 2001, 125:793-795 10 Kato T, Kubota Y, Saitu M, Yaguchi H, Sasagawa I, Nakada T, Yuda F: Osteosarcoma of the bladder successfully treated with partial ... Nogueira Carballedo C, Garc a Rego JA, Cachay Ayala M, Lorenzo Franco J, Cuerpo Pérez MA, Nieto Garc a J: Primary bladder osteosarcoma treated with hemicystectomy Actas Urol Esp 2002, 26:226-230 Baydar...

Ngày tải lên: 11/08/2014, 11:23

3 361 0
Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams pot

Familiar Letters of John Adams and His Wife Abigail Adams During the Revolution with a Memoir of Mrs. Adams pot

... Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam Abigail Adams During the Revolution, by John Adams and Abigail Adams and Charles Francis Adams ... "What you think of that, Mr Adams?" Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles Francis Adam 25 I answered, "I can't say but mobs and violence may have ... Paine, a sister of Robert Treat Paine, and for many years an intimate friend of the writer.] 19 JOHN ADAMS Familiar Letters of John Adams and His Wife by John Adams and Abigail Adams and Charles...

Ngày tải lên: 23/03/2014, 04:20

269 350 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt

Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt

... formulate a differential diagnosis (Table 52-4) For instance, the finding of scaling papules (present in patients with psoriasis or atopic dermatitis) places the patient in a different diagnostic ... lesions If the examiner focuses on linear erosions overlying an area of erythema and scaling, he or she may incorrectly assume that the erosion is the primary lesion and the redness and scale are secondary, ... raised, often translucent lesion >0.5 cm in diameter Wheal: A raised, erythematous, edematous papule or plaque, usually representing short-lived vasodilatation and vasopermeability Telangiectasia:...

Ngày tải lên: 06/07/2014, 20:20

5 414 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 2) potx

Chapter 052. Approach to the Patient with a Skin Disorder (Part 2) potx

... and are caused by scratching Atrophy: An acquired loss of substance In the skin, this may appear as a depression with intact epidermis (i.e., loss of dermal or subcutaneous tissue) or as sites of ... or character Sites on hair-bearing areas may be characterized by destruction of hair follicles Table 52-3 Common Dermatologic Terms Alopecia: Hair loss; it may be partial or complete Annular: ... of epidermis without an associated loss of dermis Ulcer: Loss of epidermis and at least a portion of the underlying dermis Excoriation: Linear, angular erosions that may be covered by crust and...

Ngày tải lên: 06/07/2014, 20:20

5 334 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 4) doc

Chapter 052. Approach to the Patient with a Skin Disorder (Part 4) doc

... lesions, the shape of individual lesions, and the arrangement of the lesions An ideal skin examination includes evaluation of the skin, hair, and nails as well as the mucous membranes of the mouth, ... lesions and make it possible to assess the distribution of the eruption accurately The patient should first be viewed from a distance of about 1.5–2 m (4–6 ft) so that the general character of the ... erythematous exanthem is more likely to have a drug eruption than is a patient with a similar rash limited to the sun-exposed portions of the face Once the distribution of the lesions has been established,...

Ngày tải lên: 06/07/2014, 20:20

5 414 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 5) pptx

Chapter 052. Approach to the Patient with a Skin Disorder (Part 5) pptx

... A D The distribution of some common dermatologic diseases and lesions Figure 52-7 Psoriasis This papulosquamous skin disease is characterized by small and large erythematous papules and plaques ... skin disease is characterized by small and large erythematous papules and plaques with overlying adherent silvery scale Figure 52-8 ...

Ngày tải lên: 06/07/2014, 20:20

5 321 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 6) pdf

Chapter 052. Approach to the Patient with a Skin Disorder (Part 6) pdf

... contact (Fig 52-10) or primary irritant dermatitis In contrast, lesions with a generalized arrangement are common and suggest a systemic etiology Figure 52-9 Erythema multiforme This ... This eruption is characterized by multiple erythematous plaques with a target or iris morphology It usually represents a hypersensitivity reaction to drugs (e.g., sulfonylamides) or infections ... reaction to drugs (e.g., sulfonylamides) or infections (e.g., HSV) (Courtesy of the Yale Resident's Slide Collection; with permission.) Figure 52-10 ...

Ngày tải lên: 06/07/2014, 20:20

5 319 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 7) ppt

Chapter 052. Approach to the Patient with a Skin Disorder (Part 7) ppt

... psoriasis, or acne) 10 Social, sexual, or travel history as relevant to the patient DIAGNOSTIC TECHNIQUES Many skin diseases can be diagnosed on gross clinical appearance, but sometimes relatively ... or saucerized with a scalpel or removed by punch biopsy In the latter technique, a punch is pressed against the surface of the skin and rotated with downward pressure until it penetrates to the ... blade, and the removed scale is collected on a glass microscope slide then treated with to drops of a solution of 10–20% KOH KOH dissolves keratin and allows easier visualization of fungal elements...

Ngày tải lên: 06/07/2014, 20:20

5 398 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 8) pptx

Chapter 052. Approach to the Patient with a Skin Disorder (Part 8) pptx

... noting the amount of blanching that occurs Granulomas often have an opaque to transparent, brown-pink "apple jelly" appearance on diascopy Figure 52-11 Urticaria Discrete and confluent, edematous, ... erythematous papules and plaques are characteristic of this whealing eruption Wood's Light A Wood's lamp generates 360-nm ultraviolet (or "black") light that can be used to aid the evaluation of ... under a Wood's lamp, and previously unsuspected areas of involvement often become apparent A Wood's lamp may also aid in the demonstration of tinea versicolor and in recognition of ash leaf spots...

Ngày tải lên: 06/07/2014, 20:20

5 367 0
Báo cáo y học: "In silico experimentation with a model of hepatic mitochondrial folate metabolism" pps

Báo cáo y học: "In silico experimentation with a model of hepatic mitochondrial folate metabolism" pps

... our model Full details of the model and the full names of all Figure Diagram 1of the reactions modeled in the present paper Diagram of the reactions modeled in the present paper Pink rectangles ... this paper Rectangular boxes represent the substrates that can vary in the model, and the ellipses contain the acronyms of the enzymes that catalyze specific reactions Full names of the substrates ... substantially, but the DNA methylation rate is very stable because the extra methyl groups are carried by an increase in the rate of the GNMT reaction during loading The rise in SAM also causes an...

Ngày tải lên: 13/08/2014, 16:21

11 207 0
Báo cáo hóa học: " The role of perfusion CT in identifying stroke mimics in the emergency room: a case of status epilepticus presenting with perfusion CT alterations" pdf

Báo cáo hóa học: " The role of perfusion CT in identifying stroke mimics in the emergency room: a case of status epilepticus presenting with perfusion CT alterations" pdf

... Relative MTT and absolute CBV are CT perfusion parameters that help define areas of infarct from areas of penumbra [6] Its use has also been investigated for the diagnosis of seizures [13,14] Hauf ... decreased availability in contrast to the short acquisition time and wide availability for NCCT in the emergency room setting There are data supporting the use of CT perfusion in acute stroke management ... f-MRI in patients with focal epilepsy [16,17] CT perfusion has the advantages of routine availability, short acquisition time, and quantitative results This case further supports the role of CT...

Ngày tải lên: 21/06/2014, 19:20

4 447 0
Báo cáo y học: "Use of intravitreal bevacizumab in a patient with a Von Hippel-Lindau-associated retinal haemangioblastoma of the optic nerve head: a case report" docx

Báo cáo y học: "Use of intravitreal bevacizumab in a patient with a Von Hippel-Lindau-associated retinal haemangioblastoma of the optic nerve head: a case report" docx

... laser and transpupillary thermotherapy However, because of previously reduced vision with laser photocoagulation the patient declined further laser therapy Treatment with intravitreal bevacizumab ... bevacizumab injections in a patient with VHL and a peripapillary retinal haemangioblastoma Treatment with ranibizumab in patients early in the course of their disease, who have no systemic tumours, ... presentation, post laser laser Fundal Photo – Six years after presentation, post argon laser therapy; note the pigmentation at the site of the laser Discussion Treatment with intravitreal bevacizumab...

Ngày tải lên: 11/08/2014, 23:21

4 263 0
Testing a model of customer-based brand equity in the Vietnamese banking servic

Testing a model of customer-based brand equity in the Vietnamese banking servic

... previously, rational and emotional evaluations are made basing on the customer’s perception about rational and emotional brand associations that they have with the brand Therefore, the following hypotheses ... words, the customer compares the quality that they perceived with their actual experience with the brand to evaluate the value they receive by consuming the brand Another way that value is created ... perceived quality, 4) brand associations (which are driven by brand 11 identity: the brand as a product, the brand as an organization, the brand as a person and the band as a symbol) The fifth...

Ngày tải lên: 06/11/2012, 15:52

81 563 1
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

... GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA ... GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC ... was used together with different forward primers for the first PCR: 5¢-GTGCCACAGGGATAGCCTGGAGGTG-3¢ (Phe718 fi Ala), and 5¢-CCAGCCACAGAGGCTCCAG ACAGGGACAGG-3¢ (Val736 fi Ala) The megaprimers obtained...

Ngày tải lên: 16/03/2014, 12:20

15 337 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

... bootstrap analysis of the sequence data with the same software To evaluate the pathogenic activity of the strain, the aseptically cultured potato microtubers in vitro were used as described by Lawrence ... fi6 )a- D-Glcp-(1fi4)-b-D-ManpNAc3NAcA-(1fi was the major component of the cell wall preparation The absolute configuration of glucose (D-) isolated after hydrolysis of the total cell wall preparation was determined ... C-3 of this sugar The signal of the H-5 of this sugar appeared as a doublet, which suggests the absence of protons at H-6 In addition, the HMBC spectrum has shown a correlation of H-4 and H-5 with...

Ngày tải lên: 17/03/2014, 10:20

6 561 0
Care of the Patient with Retinal Detachment And Related Peripheral Vitreoretinal Disease docx

Care of the Patient with Retinal Detachment And Related Peripheral Vitreoretinal Disease docx

... surgery, approximately 40 percent of patients with a retinal detachment have had prior cataract extraction.73 Cataract patients with extracapsular cataract extraction (ECCE) and intraocular lens ... Retinal Dialysis A retinal tear that occurs at the ora serrata, concentric with the ora, is called a retinal dialysis Most of these tears are less than 90 degrees, and they are rarely bilateral The ... retina appears more red than the surrounding retina, and the apex of the tear almost always points to the Retinal tufts are small areas of gliotic degeneration of the retina associated with vitreous...

Ngày tải lên: 22/03/2014, 09:20

41 352 0
Báo cáo khoa học: "A MODEL OF PLAN INFERENCE THAT DISTINGUISHES BETWEEN THE BELIEFS OF ACTORS AND OBSERVERS" pot

Báo cáo khoa học: "A MODEL OF PLAN INFERENCE THAT DISTINGUISHES BETWEEN THE BELIEFS OF ACTORS AND OBSERVERS" pot

... could mean an appropriate abstract strncture some sort of partial function from circumstances to actions, perhaps On the other hand, [it] could mean an appropriate state of mind, one naturally describable ... actions, the advantages of the alternative definition will not be discussed 208 more general statement regarding the fact that each act plays a role in the plan The relation BEL(G,P,t) should be taken ... plan with an executable queried act, but unexecutable goal act This range of invalidities accounts for a great deal of the information conveyed in naturally occurring dialogues But there is an...

Ngày tải lên: 31/03/2014, 17:20

8 232 0
w