preparation characterization and testing

Preparation, characterization and gas sensitivity ofpolypyrrole/g-Fe2O3hybrid materials

Preparation, characterization and gas sensitivity ofpolypyrrole/g-Fe2O3hybrid materials

... From the TEM and HRTEM micrographs of S2(150 8C), the amorphous polymer, granular and stick g-Fe2O3 particles could be seen, and the length and width of the stick form was about 200 nm and 15 nm, ... 8C, 60 8C and 90 8C (Fig 6) The response and recovery times of S1(150 8C) were 12–36 s and 20–22 s, respectively, at different working temperatures, and those of S2(150 8C) were 17–40 s and 20–23 ... bond, and the pyrrole ring bonds (1407, 1398, 1047, 930, 790 cmÀ1) In the S1(150 8C) and S2(150 8C) spectra, characteristic peaks of PPy were also found at 1407, 1398, 1047, 930 and 790 cmÀ1, and...

Ngày tải lên: 21/03/2014, 12:17

5 633 0
Preparation, characterization and application of heterogeneous solid base catalyst for biodiesel production from soybean oil

Preparation, characterization and application of heterogeneous solid base catalyst for biodiesel production from soybean oil

... ash content and total glycerol content, were determined and listed in the Table Table also showed comparisons of the obtained biodiesel and the standards of biodiesel in china, Europe and the United ... (mixture of catalyst and reactants) was become too viscous giving rise to a problem of mixing and a demand of higher power consumption for adequate stirring On the other hand, when the catalyst ... lifetime and better stability than current homogeneous catalysts It is noncorrosive and environmentally benign It can be applied to produce biodiesel commercially 3.4 Characterization and properties...

Ngày tải lên: 05/05/2014, 08:42

9 680 0
Báo cáo hóa học: " Preparation, characterization and photocatalytic behavior of WO3-fullerene/TiO2 catalysts under visible light" pot

Báo cáo hóa học: " Preparation, characterization and photocatalytic behavior of WO3-fullerene/TiO2 catalysts under visible light" pot

... both the conduction band (CB) and the valence band (VB) of WO3 were higher than the CB and VB of TiO2 and fullerene When the hole and electron pairs were also generated and separated on the interface ... WO3, and TiO2 Because of the least band gap of fullerene (1.6 to 1.9 eV), hole and electron pairs were generated and separated on the interface of fullerene easily by visible light irradiation, and ... MZD defined the research theme MZD and WCO designed methods and experiments, and experiments and wrote the paper LZ carried out the laboratory experiments JGC and CYP analyzed the date, interpreted...

Ngày tải lên: 21/06/2014, 01:20

11 392 0
Báo cáo hóa học: " Nanospheres: Preparation, Characterization, and Their Adsorption Properties" docx

Báo cáo hóa học: " Nanospheres: Preparation, Characterization, and Their Adsorption Properties" docx

... Bovine, and Lysozyme Experimental Sodium tungstate, sodium borohydride, hydrochloric acid (37%), and ethanol were purchased from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China) and used ... of the reaction, the solid product was collected by centrifugation and was washed thoroughly using pure water and ethanol, and finally dried at 80 °C under a vacuum (0.01 Torr) Scanning electron ... (4f7/2 and 4f5/2) in the hollow Na0.15WO3 nanospheres observed Figure shows the XPS spectrum of W in the hollow NaxWO3 nanospheres The two major W 4f7/2 and 4f5/2 peaks centered at 35.75 and 37.58...

Ngày tải lên: 22/06/2014, 00:20

6 312 0
báo cáo khoa học: "Cationic nanoparticles for delivery of amphotericin B: preparation, characterization and activity in vitro" potx

báo cáo khoa học: "Cationic nanoparticles for delivery of amphotericin B: preparation, characterization and activity in vitro" potx

... mobility µ and Smoluchowski's equation, ζ = µη/ε, where η and ε are medium viscosity and dielectric constant, respectively All Dz and ζ were obtained at 25°C, h after mixing Optical spectra and aggregation ... Figure 10 between Candida albicans viability (%) and zetapotential (mV) Correlation for AmB formulation at low (ᮀ) and high P (l) Correlation between Candida albicans viability (%) and zeta-potential ... stability was very narrow and around mg/ mL PDDA Below and above this concentration, about 300 nm and negative zeta-potentials, or 500–700 nm of zeta-average diameter and positive zeta-potentials...

Ngày tải lên: 11/08/2014, 00:22

13 774 0
Preparation, characterization and property studies of carbon nanostructures derived from carbon rich materials

Preparation, characterization and property studies of carbon nanostructures derived from carbon rich materials

... Mechanical Characterization 116 4.2.6 Electrical Characterization 117 4.3 Results and Discussion 117 v 4.3.1 Characterization of Graphene and Graphene/PVC Thin 117 Films 4.3.2 Mechanical Characterization ... methods of preparation, characterization techniques, properties, functionalization techniques and applications have been explained in Chapter Chapter deals with the isolation and characterization ... 2.2.1 Reagents and Materials 71 2.2.2 Sample Preparation 72 2.2.3 Isolation of CNFs 72 2.2.4 Preparation of Electrospun CNF/PVA Composite 72 Nanofiber Mats iii 2.2.5 Materials Characterization...

Ngày tải lên: 10/09/2015, 15:48

210 266 0
Characterization and testing of nanofluid cooling technology for electronic systems

Characterization and testing of nanofluid cooling technology for electronic systems

... Hill et al (1963) and later developed by Andres et al (1981) and Brown et al (1992) Although a certain degree of agglomeration may occur in the nanoparticle preparation, storage and dispersion processes, ... their full support and great assistance in experiment preparation throughout the duration of this project Special thanks to his laboratory colleagues and friends for their kind help and enlightening ... common method is to add activators and dispersants, which are normally thiols, oleic acid and laurate salts (Xuan and Li, 2000) Selection of the suitable activators and dispersants mainly depends...

Ngày tải lên: 03/10/2015, 20:31

211 459 0
chemistry of superconductor materials; preparation, chemistry, characterization and theory, vanderah, 839pp

chemistry of superconductor materials; preparation, chemistry, characterization and theory, vanderah, 839pp

... materials : preparation, chemistry, characterization and theory / edited by Term11 A Vanderah p cm Includes bibliographical references and index ISBN O-8155-1279-1 : Superconductors-Chemistry I Vanderah, ... HANDBOOK: by by James J Licari and Leonard R HANDBOOKOFTHfNFllMOEPOSmONPROCESSESANDTH=HNIQUES:editedbyKlaus K Schuegraf AND EPlTAXYz by Toshinori Takagi -BEAM- MFFUSK)NPHENOMENAINTHiNFli_MBANDMICROELECTRONK=MATEFU_Seditedby ... CERAMKX AND CEFMMKZ SUpERcoNwcToRs: David E Clark and Bruce K Zoitos edited by Related Titles ADHEWES TEcHNou)(jY HANDBOOK OF lHEFMXi3 SURFACE -MLON Wegman FOFMUlATlNG HANDBOCX by Arthur H Landrock...

Ngày tải lên: 09/05/2014, 17:09

839 286 0
Characterization and deactivation of sulfided red mud used as hydrogenation catalyst

Characterization and deactivation of sulfided red mud used as hydrogenation catalyst

... Christov and M Marshall, Fuel, 71 (1992) 449 B Klopties, W Hodek and F Bandermann, Fuel, 69 (1990) 448 K.C Pratt and V Christoverson, Fuel, 61 (1982) 460 J.J Llano, R Rosal, H Sastre and F.V Dfez, ... completely deactivated These samples, and samples of fresh unsulfided and sulfided catalyst, were characterized by nitrogen adsorption and SEM The results of textural characterization by nitrogen adsorption ... Hawkins, J.F Fryer and J.G Speight, Fuel, 59 (1980) 647 [11] T Yotono and H Marsh, in H.D Schultz (Editor), Coal Liquefaction Products: NMR Spectroscopic Characterization and Production Processes,...

Ngày tải lên: 23/09/2012, 14:46

15 509 0
Training for Impromptu Speaking and Testing Active Listening

Training for Impromptu Speaking and Testing Active Listening

... called in to present, and the other groups are ready to watch theirs for the second time Meanwhile the first group to finish will now join wathing the speeches of the second group, and the audience ... increases The fourth and final stage: When everybody is back into the big class group, students are then ready to ask questions, by being encouraged to so or being assigned beforehand, about things ... encouraged to so or being assigned beforehand, about things they did not fully understand in the other groups video segments and which they find interesting What are the advantages of this technique? First,...

Ngày tải lên: 06/09/2013, 10:10

2 395 1
Viewing a WSDL File and Testing a Web Service

Viewing a WSDL File and Testing a Web Service

... Figure 17.5 Notice that the equals (=) and single quote (') characters in the whereClause parameter value of the URL have been converted to the codes %3D and %27 respectively Figure 17.5: Running ... location="http://localhost/NorthwindWebService/Customers.asmx" /> Next, you'll see how to test your Web service Testing a Web Service To test your Web service, point your browser to the following URL: http://localhost/NorthwindWebService/Customers.asmx ... next section Let's take a look at another example; enter the following string as your whereClause and click the Invoke button: CustomerID IS NOT NULL This causes the RetrieveCustomers() method to...

Ngày tải lên: 24/10/2013, 12:15

7 382 0
Tài liệu CERTIFICATION AND TESTING UNDER THE CPSIA _______________________________________________ doc

Tài liệu CERTIFICATION AND TESTING UNDER THE CPSIA _______________________________________________ doc

... of testing by an accredited lab must be in English • May be in an additional language • Include manufacturer name, date and place of manufacturing • Include testing laboratory name, date and ... the Commission, and may not reflect its views Bài thuyết trình nhân viên CPSC sọan, chưa Ủy Ban xem xét hay phê chuẩn không phản ảnh quan điểm Ủy Ban 28 Mandatory and Third Party Testing for Certain ... the Commission, and may not reflect its views Bài thuyết trình nhân viên CPSC sọan, chưa Ủy Ban xem xét hay phê chuẩn không phản ảnh quan điểm Ủy Ban 29 Mandatory and Third Party Testing for Certain...

Ngày tải lên: 10/12/2013, 06:15

30 489 0
Tài liệu Chapter 11 - Configuring and Testing Your Network ppt

Tài liệu Chapter 11 - Configuring and Testing Your Network ppt

... Operating System (IOS) Use Cisco CLI commands to perform basic router and switch configuration and verification Given a network addressing scheme, select, apply, and verify appropriate addressing parameters ... Context-sensitive help – Command Syntax Check – Hot Keys and Shortcuts H c vi n m ng Bách khoa - Website: www.bkacad.com Command Syntax Check H c vi n m ng Bách khoa - Website: www.bkacad.com Command Syntax Check ... Aborts the current command and exits the configuration mode H c vi n m ng Bách khoa - Website: www.bkacad.com Examination Commands • Identify the purpose of the show command and several of its variations...

Ngày tải lên: 22/12/2013, 13:17

70 441 0
Tài liệu Optical Connector Tuning and Testing doc

Tài liệu Optical Connector Tuning and Testing doc

... direct effect on randomly intermated connector performance and is improved through an automated process Optical Connector: Tuning and Testing Introduction Transverse, longitudinal, and angular misalignments ... loss 0.1 (connector A and C together) 0.002 dB 1.0 (connector B and D together) 0.20 dB Optical Connector: Tuning and Testing Figure Intermated Insertion Loss Connectors B and D have the least ... and Testing When a tuned connector is intermated with any other tuned connector, any offset of the fiber cores will be in a common direction and sector Therefore, the insertion loss of the randomly...

Ngày tải lên: 24/01/2014, 11:20

8 301 0
Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc

Tài liệu Step-by-Step Guide for Creating and Testing Connection Manager Profiles in a Test Lab doc

... Configuring and Testing a Dial-Up Profile Configuring and Testing a PPTP Profile 29 Configuring and Testing an L2TP/IPSec Profile .39 Configuring and Testing an EAP ... Administrative Tools, and click Routing and Remote Access In the console tree, right-click VPN1, and click Configure and Enable Routing and Remote Access On the Welcome to the Routing and Remote Access ... must have two network adapters and a modem Windows Server 2003 White Paper Perform basic installation and configuration Install Windows Server 2003, Standard Edition, and configure the computer as...

Ngày tải lên: 27/01/2014, 15:20

59 1,1K 0
Tài liệu Báo cáo khoa học: Pyrimidine-specific ribonucleoside hydrolase from the archaeon Sulfolobus solfataricus – biochemical characterization and homology modeling doc

Tài liệu Báo cáo khoa học: Pyrimidine-specific ribonucleoside hydrolase from the archaeon Sulfolobus solfataricus – biochemical characterization and homology modeling doc

... hypoxantine, guanosine and guanine, uridine and uracil, cytidine and cytosine were 12.2 and 6.2 min, 10.5 and 4.7 min, 15.2 and 6.1 min, 6.8 and 4.2 and 6.6 and 3.9 respectively The amount of purine ... employed and the elution was carried out with : 94 (v v) mixture of 95% methanol and 0.1% triuoroacetic acid in H2O The retention times of adenosine and adenine, inosine and hypoxantine, guanosine and ... A, we were able to calculate the volume of buried and surface cavities for SsCUNH and the template, both in the monomer and in the tetramer, and we found that the volume of buried cavities found...

Ngày tải lên: 18/02/2014, 17:20

15 557 0
Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt

Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt

... crystallization After hard screening for detergents and additives, the crystals grew and finally diffracted to ˚ 2.4 A using synchrotron radiation With preparation and crystallization as described below, ... modulate the interaction between membrane protein and detergent Results and Discussion The mitochondrial respiratory complex II preparation was extracted and purified from porcine heart The major purification ... subunit The FP band is not very clear in the agarose gel, and the longest band was used to run another PCR reaction for amplification Experimental procedures Extraction, purification and crystallization...

Ngày tải lên: 19/02/2014, 02:20

6 469 0
Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

Tài liệu Báo cáo khoa học: Biochemical characterization and inhibitor discovery of shikimate dehydrogenase from Helicobacter pylori docx

... (Eqn 2) On the other hand, compounds 1, 4, and are noncompetitive inhibitors, and compounds and are competitive inhibitors with respect to NADP Table summarizes the IC50 values and kinetic inhibition ... a-helix, b-sheet, b-turn, and random coil in HpSDH are, respectively, 16.6, 49.2, 1.5, and 32.6% processed by jasco secondary structure estimation software The percentage for random coil of HpSDH is ... HpSDH and the effects of pH and temperature on HpSDH The results show that HpSDH has a kcat of 7.7 ± 0.9 s)1, Km of 0.148 ± 0.028 mm and kcat ⁄ Km of 5.2 · 104 m)1Æs)1 toward shikimate, and a...

Ngày tải lên: 19/02/2014, 05:20

11 529 0
Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt

Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt

... 0.1% TFA in water and 20% of 0.1% TFA in 40% acetonitrile Excitation and emission wavelengths of the fluorescence detector were set at 450 and 525 nm, respectively FAD and FMN standards were used ... CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG MfeI and PstI sites were inserted in forward and reverse primers, respectively, upstream and downstream the start and the stop codons, whereas a (His)6coding ... The amplified DNA was digested by MfeI and PstI and ligated into the ampicillin-resistant expression vector pSD80 [43], which was digested by EcoRI and PstI, and introduced by electroporation in...

Ngày tải lên: 19/02/2014, 06:20

13 440 0
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

... and the cysteine residues alkylated in order to verify their identification Although there are standard procedures for reduction and alkylation, their application to conopeptide analysis and characterization ... a-conotoxins and two disulfide bonds (identified by partial reduction and alkylation studies and MS/MS) It may also include diagnostic LC/MS for recognition of some posttranslational modifications and possibly ... the muscle-acting a-conotoxins GI and GII together with the neuronally acting a-conotoxins GIC and GID [1,5,10] and C magus venom contains the 2296 M L Loughnan and P F Alewood (Eur J Biochem 271)...

Ngày tải lên: 19/02/2014, 12:20

11 554 0
w