precisely particularly in relation to each other the grid can be shown or hidden grids are not visible in a slide show and they do not print
Báo cáo khoa học: "Abietane and pimarane diterpene acid evolution in Scots pine Pinus sylvestris needles in relation to feeding of the pine sawfly, Diprion pini L." docx
Ngày tải lên :
09/08/2014, 03:24
... resin acids were estimated by peak area triangulation, compared with resin acid standard solutions and corrected by reference to an internal standard of methylpalmitate The reported data are the ... conclude that, if the abietane and pimarane diterpene acids of Scots pine needles can interfere in the D pini development, they probably cannot be considered as determinant factors for the natural equilibria ... compounds affecting sawfly larval development If abietane and pimarane diterpere acids interfere with larval mortality and feeding behaviour in D pini, the qualitative and quantitative evolutions of these...
- 11
- 303
- 0
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
Ngày tải lên :
23/03/2014, 17:21
... catalytic activity was lost in the mutants, the ligand-binding capability and thus the pentacoordinate nature of the heme was conserved Significantly, typical c-cytochrome a and b maxima not appear ... 5¢-GTAACTGTAAGAGAACTGGTCAC-3¢ (Lys70 to Arg), 5¢-GTAACTGTAGCAGAACTGGTCA G-3¢ (Lys70 to Ala), and 5¢-GGTAACTGTATATGAA CTGGTCAG-3¢ (Lys70 to Tyr) The resulting plasmids, pUCYPKR, pUCYPKA, and pUCYPKY, ... while absorbance at 500 nm decreased and absorbance at 620 increased slightly (data not shown) Cytochrome P460 expressed in P aeruginosa catalyzed the oxidation of either hydroxylamine or hydrazine,...
- 7
- 384
- 1
báo cáo sinh học:" Effectiveness of a training-of-trainers model in a HIV counseling and testing program in the Caribbean Region" pot
Ngày tải lên :
18/06/2014, 17:20
... Grenadines, and Surinam in 2003; to Barbados and the Bahamas in 2004; and to Anguilla, Antigua & Barbuda, Dominica, Grenada, and Turks & Caicos in 2005 Clinical Skills Course Data from the telephone ... clinical training skills and advanced training skills, as well as the number of trainings each clinical trainer and advanced trainer had conducted since the training http://www.human-resources-health.com/content/7/1/11 ... is the "top" of the trainer pathway Master trainers are able to design trainings and conduct advanced training skills courses The goal for a training program using this TOT model would be to...
- 8
- 450
- 0
báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf
Ngày tải lên :
20/06/2014, 07:20
... obstacle that impedes successful chemotherapy and a major cause of treatment failure in human OvCa The balance between survival and apoptotic signals determine a cell's sensitivity to chemotherapy ... chemotherapy Indeed, cancer cells develop resistance to chemotherapy by means of inactivating apoptotic factors and enhancing survival pathways that antagonize apoptosis signals [2] However, the precise ... cell death [6] Phosphorylated Akt promotes survival by phosphorylating and inactivating proapoptotic factors, such as FKHR and GSK-3β [7] FKHR is a transcription factor that transactivates the expression...
- 8
- 316
- 0
Báo cáo khoa học: "Aboveground biomass in a beech forest and a Scots pine plantation in the Sierra de la Demanda area of northern Spain" pdf
Ngày tải lên :
08/08/2014, 18:21
... immobilized in the biomass This can be defined as rotation coefficient and has the values for the two forests con- relationship pine forests indicates a larger biomass and litterfall in the latter Although ... processes and pathways of the ecosystem (Ohmann and Gria general relationship gal, 1985) The aim of the present work was to compare certain structural characteristics in a climax beech forest with that ... vegetation is subject to external environmental factors net such as soil and climate, and to inherent facsuch as age and the kind of tree cover (Santa Regina et al, 1991).Plants retain a substantial...
- 9
- 261
- 0
Báo cáo y học: "Retention of foreign body in the gut can be a sign of congenital obstructive anomaly: a case report" potx
Ngày tải lên :
11/08/2014, 21:22
... gastrointestinal symptoms and the investigations CM and OA carried out the radiological examination while PCS performed the surgery on the child All were major contributors in writing the manuscript and ... pancreas may present with a variety of retained foreign materials in the stomach or proximal duodenum Nuts, vegetable and fruit pits, and coins have been discovered at operation Repeated abdominal ... abdomen showing thebowel 'double Plain radiograph offew dilated loops ofpresence of ain the left Plain radiograph of the abdomen showing the metallic foreign body in the right lower quadrant, the...
- 3
- 387
- 0
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"
Ngày tải lên :
25/10/2012, 10:35
... according to the algorithm A protocol (see additional data files and 2), managed by the ICU nurses, was used for the adjustment of the insulin dose The standard insulin therapy had been the usual ... [1-4] A randomised trial of 1548 patients hospitalised in a surgical intensive care unit (ICU) showed that maintaining normal glucose levels reduces morbidity and mortality [5] In another randomised ... the 28-day mortality rate or the mean organ failure score The rate of severe hypoglycaemia, however, was higher in the intensive insulin therapy group compared with the standard insulin therapy...
- 9
- 635
- 0
Báo cáo khoa học: C-terminal truncated cannabinoid receptor 1 coexpressed with G protein trimer in Sf9 cells exists in a precoupled state and shows constitutive activity ppt
Ngày tải lên :
23/03/2014, 07:20
... with a 515 nm laser, were optimal for > 90% acceptor bleaching and minimal donor bleaching When the acceptor protein was bleached, there was an increase in donor fluorescence The increase in donor ... identified, such as the muscarinic receptor M4, the adrenergic receptor a2 A, the adenosine receptor A1 and the dopamine receptor D2, in a precoupled form to the G protein trimer (Gaob1c2) [7] It was suggested ... Overlap images show the colocalized receptor and the G protein YFP was bleached using a 515 nm laser in a donor dequenching experiment Donor dequenching gave a 7% increase in acceptor fluorescence...
- 10
- 313
- 0
Báo cáo khoa học: A structured RNA in hepatitis B virus post-transcriptional regulatory element represses alternative splicing in a sequence-independent and position-dependent manner pot
Ngày tải lên :
28/03/2014, 23:20
... (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by RT-PCR was performed using the forward primer radiolabeled ... prepared using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol Total RNA of lg was incubated with random primers, dNTPs and Moloney murine leukemia virus ... South Carolina, Charleston, SC, USA) for sending us plasmids pZW8, pDM138-PRE and pCH9 ⁄ 3091, respectively The authors are also indebted to members of the Yi Zhang laboratory for cooperation and...
- 14
- 379
- 0
Báo cáo hóa học: " Heavily glycosylated, highly fit SIVMne variants continue to diversify and undergo selection after transmission to a new host and they elicit early antibody dependent cellular responses but delayed neutralizing antibody responses" pdf
Ngày tải lên :
20/06/2014, 01:20
... to the right The parental V1 sequence is shown at the top of each alignment, and the conserved amino acids in each variant sequence are shown as dots Sites of potential N-linked glycosylation are ... from the infecting variant Percent Percent divergence from the infecting variant For each animal, genetic distances were calculated between each sequence and the infecting variant, and animals ... animals are shown in green, and those from SIVMne170- and SIVMne027-infected animals are shown in red and pink respectively The parental sequences are marked by a diamond of the respective color...
- 15
- 490
- 0
báo cáo khoa học: "CCR9-CCL25 interactions promote cisplatin resistance in breast cancer cell through Akt activation in a PI3K-dependent and FAK-independent fashion" pptx
Ngày tải lên :
09/08/2014, 01:24
... helped to draft the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing interests Received: January 2011 Accepted: 29 April ... over the dependent part was noted Discussion GISTs are uncommon tumors originating from the interstitial cells of Cajal, which are pacemaker cells regulating autonomic motor activity in the gastrointestinal ... considered initially in our case, but was excluded later due to the huge size of the calcification and because a comparison of the CT scan with an image obtained two years earlier showed that this was...
- 4
- 231
- 0
báo cáo khoa học: "Isolated angiitis of the central nervous system with tumor-like lesion, mimicking brain malignant glioma: a case report and review of the literature" pdf
Ngày tải lên :
09/08/2014, 02:20
... demyelinating or inflammatory diseases [18-20], because of similar symptoms, clinical exam and laboratory findings Besides, it is also not easy to differentiate between IACNS and lymphoma when there ... However, the classic appearance of alternating narrowing and dilatation is not completely specific and has been observed in only 25% of patients with IACNS; the angiogram is normal in up to 40% of pathologically ... infections initiate the inflammatory process that somehow becomes self-sustaining [5] It is also speculated that there may be a genetic predisposition in certain individuals leading to an enhanced...
- 4
- 333
- 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps
Ngày tải lên :
09/08/2014, 14:20
... analysis and interpretation of the data DHa and PA helped to perform analysis and interpretation of the data and to draft the manuscript VHT and UW (and the European Consortium on Rheumatoid Arthritis ... bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA-250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA250 assay, a genotyping primer bioCTCCAGAG [L]TCAGACCTTGGC, differentiating between ... Caucasian HapMap data and in our data, was experimentally shown to influence binding of the NKG2D receptor [30] Variant rs105179 2A, corresponding to MICA-25 0A, was shown to strongly bind NKG2D All other...
- 11
- 460
- 0
báo cáo khoa học: "A cytogenetic survey was carried out on fattening male and female pigs of different lines in a local herd and on " ppsx
Ngày tải lên :
09/08/2014, 22:22
... Robertsonian translocation In the other breeds investigated, this translocation was absent In an additional study of familial relationships it could be shown that all chromosomally aberrant A. I ... occurred earlier in the Landrace of GDR The increased local use of an aberrant boar in artificial insemination can lead to higher frequency, as could be observed in the present study in a local herd ... female and male animals of different lines raised on a fattening farm of the southern region of GDR, and from 461 A. I boars of a breeding station Each sample (2.0 ml) was incubated at 37 °C for...
- 7
- 313
- 0
Báo cáo y học: "Mortality associated with HIV-1, HIV-2, and HTLV-I single and dual infections in a middle-aged and older population in Guinea-Bissau" potx
Ngày tải lên :
13/08/2014, 05:22
... cohort studies, and SA was responsible for the laboratory test strategies PV and HR were responsible for the statistical analyses BH carried out the data management and data analyses and wrote the ... midpoint between date of entry into the study and the date on which the information about migration or death was obtained, because more specific information was not available Poisson regression was ... The major change around 45 years of age corresponds to the pre-menopausal and menopausal age Alterations in female hormones and the associated histological changes could induce changes in the...
- 9
- 336
- 0
towards sustainability of land use in a highly vulnerable and degraded
Ngày tải lên :
11/09/2015, 15:45
... important in capturing spatial variations of soils and if they are correctly spatially delineated, loss of soil information can be minimized and spatial soil gradation can be better seen as a continuum ... unique combinations of soils and terrain characteristics and they can be mapped The information of these units can be stored in two ways: geometry and attribute data in which an attribute characterizes ... such as landform, surface form, slope, and parent material Each combination represents a SOTER unit Data in the SOTER database are organized in: A relational data base, which consists of attribute...
- 230
- 583
- 0
Hình ảnh Protocols in relation to the OSI model.doc
Ngày tải lên :
24/08/2012, 21:11
... Gatekeeper – Call Across WAN May I call 2111 with a bandwidth of 384K? Call flow H.323 RAS signaling yes you can! IP WAN zone zone Admission Control Via Zone BandWidth in the Cisco IOS MCM Gatepeer ... G729 recovery Path Delay H.225.0 Layer H245 control System control Call control H226.0 RAS Control H×nh 3: kiÕn tróc t¹i Terminal H.323 c a Cisco Locall Area Network Intererface Admission Control ... Video Conference Architecture a typical H.323 Terminal Video I/O Equipment Audio I/O Equipment User Data Applications System Control User Interface Video codec H261, H263 Audio condec G711,...
- 4
- 774
- 2
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
Ngày tải lên :
25/10/2012, 10:45
... errors (bias and random error) related to data based on clinical examina- Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 http://www.actavetscand.com/content/51/1/36 ... Acta Veterinaria Scandinavica 2009, 51:36 Background Files with information on animal disease have a variety of applications at both the herd and national level, including monitoring the incidence ... rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters into the scoring (see Table for examples), http://www.actavetscand.com/content/51/1/36...
- 10
- 587
- 0