pre cancerous lesions and oral cancers

PROSTHETIC REHABILITATION OF MISSING TEETH AND ORAL HEALTH IN THE ELDERLY pptx

PROSTHETIC REHABILITATION OF MISSING TEETH AND ORAL HEALTH IN THE ELDERLY pptx

... Aging Study (HAS), the oral and dental status and oral hygiene habits of 364 old elderly, born in 1904, 1909 and 1914 and living in Helsinki, was examined in 1990 and 1991 (Oral- HAS) The main objective ... the presence of oral mucosal lesions and cleaning of the oral mucosa (rs= -x, p

Ngày tải lên: 05/03/2014, 18:20

59 597 0
Enhancing Partnerships for Head Start and Oral Health: Professional Dental Organizations Synthesis Report pptx

Enhancing Partnerships for Head Start and Oral Health: Professional Dental Organizations Synthesis Report pptx

... Head Start and Head Start Both pediatric dentists and dental hygienists expressed the need for more standardized and effective collection of data for this population in order to quantify oral health ... serve children and pregnant women in Early Head Start and Head Start Disconnect between oral health and general health Participants also noted the general lack of emphasis given to oral health in ... relating to the oral health of young children: Dental and health professionals need to be educated about the oral health needs of Head Start children and families and effective oral health practices...

Ngày tải lên: 05/03/2014, 23:20

9 260 0
Water Pollution and Digestive Cancers in China doc

Water Pollution and Digestive Cancers in China doc

... found connections between water quality and acute water-borne diseases such as typhoid (Cutler and Miller 2005) and diarrhea (Jalan and Ravalion 2003), and access to cleaner water may lower infant ... DSP sites between 1991 and 2000, and population counts by age and sex that are used to convert the Wang and Wheeler (1996), in an analysis on provincial data from 1987-1989 and 1992-1993, estimate ... cancer rates The measure is taken between zero and 1, with higher numbers representing higher optical depth and implying the presence of more particulates and worse air quality (see Figure 3) I assign...

Ngày tải lên: 06/03/2014, 15:21

46 456 0
MASTER DENTISTRY: vol 1 Oral and Maxillofacial Pathology and Oral Medicine pot

MASTER DENTISTRY: vol 1 Oral and Maxillofacial Pathology and Oral Medicine pot

... disciplines of oral and maxillofacial surgery, oral and maxillofacial radiology, oral and maxillofacial pathology and oral medicine have been brought together to provide an understanding of clinical ... MASTER DENTISTRY Oral and Maxillofacial Surgery Oral and Maxillofacial Surgery, Radiology, Pathology and Oral Medicine Paul Coulthard BBS MFGDP MDS FDSRCS PHD Senior Lecturer in Oral and Maxillofacial ... Control of pain and anxiety 37 Infection and inflammation of the teeth and jaws 59 Removal of teeth and surgical implantology 79 Diseases of bone and the maxillary sinus 101 Oral and maxillofacial...

Ngày tải lên: 15/03/2014, 17:20

277 5,6K 1
Guidance on Cancer Services - Improving Outcomes in Head and Neck Cancers pot

Guidance on Cancer Services - Improving Outcomes in Head and Neck Cancers pot

... group also includes cancers and sarcomas of the facial bones, peripheral nerves, connective and soft tissues, and various glands Skull base cancers are included among head and neck cancers, but tumours ... cancers It provides general information on the nature of these diseases, incidence and survival rates, treatment and rehabilitation, epidemiology, risk factors, and prevention Head and neck cancers ... England are inferior to those in comparable countries, and it is therefore reasonable to conclude that there is room for improvement Specific cancers Mouth, lip and oral cavity (oral cancer) Oral...

Ngày tải lên: 22/03/2014, 16:21

165 356 0
Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf

Báo cáo khoa học: Constitutive expression of the human peroxiredoxin V gene contributes to protection of the genome from oxidative DNA lesions and to suppression of transcription of noncoding DNA pdf

... (exons and underlined) were: TTTGAGA ACCTCTTGAGACGTCGATGACGTCTCAAGAGGTTC TCTTTTT (top strand) and CTAGAAAAAGAGAA CCTCTTGAGACGTCATCGACGTCTCAAGAGGTTCT (bottom strand) Targeted segments are present ... electrophile response elements (EpREs), which bind a common set of transcription factors and thus induce Phase II enzymes and stress proteins [21] Of the ARE ⁄ EpRE-binding proteins, an important ... ARE-mediated gene expression [24] PRDX1 gene expression is known to be activated in mouse macrophages in a NRF2dependent manner by oxidative stress and electrophilic agents [25] and in mouse lungs...

Ngày tải lên: 30/03/2014, 11:20

11 463 0
enterprise network testing [electronic resource] the role and applications of testing in pre-peployment, migration, and post-deployment, network operations

enterprise network testing [electronic resource] the role and applications of testing in pre-peployment, migration, and post-deployment, network operations

... particular Ixia Networks and Spirent Communications, for their outstanding products and technical support; and Thomas Maufer, for an excellent contribution on application simulation, and the Mu Dynamics ... Boldface indicates commands and keywords that are entered literally as shown In actual configuration examples and output (not general command syntax), boldface indicates commands that are manually ... transit While popular and powerful, TelePresence imposes unprecedented demands on the network, as it must deliver and synchronize ultrahigh-definition video and high-quality audio according to stringent...

Ngày tải lên: 30/05/2014, 23:50

624 1,8K 0
báo cáo hóa học: " Social and dental status along the life course and oral health impacts in adolescents: a population-based birth cohort" ppt

báo cáo hóa học: " Social and dental status along the life course and oral health impacts in adolescents: a population-based birth cohort" ppt

... analysis and interpretation of data, and drafted the manuscript MAP participated in the collection, analysis and interpretation of data, and revising critically the manuscript CLPA, AMBM, and PCH ... less access to (and use of) dental services and a variety of oral hygiene items, and may be more likely to develop harmful oral health behaviours later in life [15] These might predispose individuals ... socioeconomic,Performance and dental status and Conceptual framework demographic(OIDP) Conceptual framework of the relationship between life course socioeconomic, demographic and dental status and Oral Impacts...

Ngày tải lên: 18/06/2014, 19:20

10 469 0
báo cáo hóa học:" Association between perceived chewing ability and oral health-related quality of life in partially dentate patients" ppt

báo cáo hóa học:" Association between perceived chewing ability and oral health-related quality of life in partially dentate patients" ppt

... temporomandibular disorders J Oral Rehabil 2001, 28:463-465 31 Steele JG, Sanders AE, Slade GD, Allen PF, Lahti S, Nuttall N, Spencer AJ: How age and tooth loss affect oral health impacts and quality ... with chewing ability [30] and OHRQoL [31,32] in previous studies On the other hand, we observed that the correlation between both constructs was different in men and women and in two categories of ... Lawrence Erlbaum, 1988 28 Kida IA, Astrom AN, Strand GV, Masalu JR, Tsakos G: Psychometric properties and the prevalence, intensity and causes of oral impacts on daily performance (OIDP) in a population...

Ngày tải lên: 20/06/2014, 15:20

6 351 0
w