porras j fernandez rossier and c tejedor
Some observations of the effects of time on the capacity of piles driven in sand R. J. JARDINE, J. R. STANDING and F. C. CHOW†
Ngày tải lên :
13/08/2015, 10:38
... effective stresses and shaft capacity recovery An experiment was conducted on pile R4 to assess whether low-level cyclic loading could accelerate the postulated arching creep processes and enhance ... Offshore Technology Conf., Houston, 145154 Bullock, P & Schmertmann, J H (1995) Personal communication 244 JARDINE, STANDING AND CHOW Bullock, P J. , Schmertmann, J H., McVay, M C & Townsend, F C (2005a) ... of compression tests, tension load tests and Osterberg cell tests Note that the capacities of piles driven in mica and calcareous sands may be poorly predicted by standard pile capacity calculations;...
- 19
- 449
- 0
The 8051 microcontroller and embedded systems using assembly and c 2nd ed
Ngày tải lên :
04/10/2013, 19:10
... applications in which cost and space are critical In many applications, the space it takes, the power it consumes, and the price per unit are much more critical considerations than the computing ... of Computer Science and Information Engineering National Cheng Kung University, TAIWAN 34 INSIDE THE COMPUTER Ex (cont’) The CPU decodes the instruction B0 The CPU commands its controller circuitry ... COMPUTER Inside CPUs (cont’) ALU (arithmetic/logic unit) Performs arithmetic functions such as add, subtract, multiply, and divide, and logic functions such as AND, OR, and NOT Program counter Points...
- 617
- 965
- 0
The 10 Most Significant Differences between C# and C++
Ngày tải lên :
04/10/2013, 21:20
... public class Account { private double balance; private int numChecksProcessed; private CheckBook checkBook; public Account() { balance = 0.0; numChecksProcessed = 0; checkBook = new CheckBook(); ... WriteLine() command, as function call, 74, 160 writing code, CD115–CD119 collection class, CD61–CD71 constant, CD6 forms code, CD175–CD179 generic code, 348–349 generic collections, 340–341 graphical ... special characters, 50–51 Split() method, 198–200, 205–206 Stack class, 335 stack object, 380 stack trace, CD13, CD135–CD136 stacking windows, CD104–CD106 starting console program by doubleclicking,...
- 35
- 471
- 0
Tài liệu Writing Apache Modules with Perl and C doc
Ngày tải lên :
21/12/2013, 11:15
... Apache Module Architecture and API 3.1 How Apache Works 3.2 The Apache Life Cycle 3.3 The Handler API 3.4 Perl API Classes and Data Structures Content Handlers 4.1 Content Handlers as File Processors ... looping constructs, and database access methods Netscape servers recognize HTML pages that have been enhanced with scraps of JavaScript code (this is distinct from client-side JavaScript, which we ... ok, access restrictions apply Remote system type is UNIX Using binary mode to transfer files ftp> cd /pub/perl/CPAN/modules/by-module 250 CWD command successful ftp> cd MD5 250 CWD command successful...
- 741
- 524
- 0
Tài liệu Debugging C and C++ code in a Unix environment ppt
Ngày tải lên :
21/01/2014, 06:20
... ‘RTFM’) comes from Unix hackerdom; see [JARGON] if you are interested in it Chapter Aspects of debugging C and C+ + code Debugging C and C+ + code entails noticing, localising, understanding and repairing ... variables) C and C+ + speci c problems There are some features of the C and C+ + languages and the associated build process that often lead to problems Preprocessor C and C+ + use a preprocessor to expand ... allocation debugging tools As discussed earlier in the section called C and C+ + speci c problems, one of the causes of problems with C and C+ + code, is the policy of requiring explicit allocation...
- 29
- 466
- 1
Tài liệu Báo cáo khoa học: Binding of N- and C-terminal anti-prion protein antibodies generates distinct phenotypes of cellular prion proteins (PrPC) obtained from human, sheep, cattle and mouse doc
Ngày tải lên :
19/02/2014, 02:20
... densitometry, which reflects differences in the ratios of the di-, mono- and nonglycosylated PrP In sporadic cases of human Creutzfeldt–Jakob disease, PrPSc shows a characteristic glycopattern with ... mono-glycosylated isoform which differs from that in ruminant BSE and scrapie PrPSc In addition to vCJD, the occurrence of other Creutzfeldt– Jakob disease subtypes with differing glycoprofiles and ... reaction (C) For glycotyping, the combined PrP signals for the di- (d), mono- (j) and nonglycosylated (m) isoform were defined as 100% and the contribution of each band was calculated as percentage...
- 11
- 536
- 0
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
Ngày tải lên :
20/02/2014, 01:20
... ATnI1F (5¢-CATATCACCATGGGTTCCCTTG-3¢) and ATnI292R (5¢-CTTGATTTGGATCCTTTAAGGTA TAGC-3¢), ATnI1F and ATnI128R (5¢-GTTCCGGATC CTATCTTCTGGCTTCC-3¢), ATnI130F (5¢-GCCAGAA CCATGGCGGAGGAAC-3¢) and ATnI292R, ... back muscle of rabbit by RT-PCR using the primer set, RTnI1F (5¢-CAAACCTCACCATGGGAGAT GAAG-3¢) and RTnI181R (5¢-CCCCGGAGCCGGATCC CCAGCCCC-3¢) These primers were designed based on the sequence ... (5¢-GAGCATGGCGGGAT CCTACATGCGCAC-3¢) and RTnI96F (5¢-GCTGGAGG CCATGGACCAGAAGC-3¢) and RTnI181R, respectively (BamHI ⁄ NcoI sites and termination ⁄ initiation codons are indicated by underlines and bold...
- 12
- 514
- 0
Trial and Error: J. Marion Sims and the Birth of Modern Gynecology in the American South docx
Ngày tải lên :
05/03/2014, 15:20
... medical research and clinical practice A physician’s personal experiences and moral ideas about science, tradition, and religion shaped their methodology and practical concerns Between 1830 and ... to Churchill’s brother Bartlett Jones, who worked as a creditor in Lancaster during 1820s and 30s.9 Sims took a few classes at a small medical college in Charleston and apprenticed with Churchill ... is crucial to consider Sims’ family history, social status, and his cultural ties to the American South as the context of his early gynecological experiments and subsequently successful medical...
- 8
- 636
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt
Ngày tải lên :
06/03/2014, 01:20
... cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the ... chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection is declining ... Academies and the Institute of Medicine Dr Ralph J Cicerone and Dr Charles M Vest are chair and vice chair, respectively, of the National Research Council www.national-academies.org PREPUBLICATION...
- 191
- 457
- 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc
Ngày tải lên :
06/03/2014, 01:20
... prevention coordinators CDC CHIP CI CIA CMS Centers for Disease Control and Prevention Children’s Health Insurance Program confidence interval enhanced chemiluminescence Centers for Medicare and Medicaid ... B and chronic hepatitis C are serious and can result in liver cirrhosis and a type of liver cancer, hepatocellular carcinoma (HCC) The prevention of chronic hepatitis B and chronic hepatitis C ... of chronic hepatitis B and chronic hepatitis C prevents the majority of HCC cases because HBV and HCV are the leading causes of this type of cancer Although the incidence of acute HBV infection...
- 253
- 369
- 0
Báo cáo khoa học: Respective roles of the catalytic domains and C-terminal tail peptides in the oligomerization and secretory trafficking of human acetylcholinesterase and butyrylcholinesterase potx
Ngày tải lên :
07/03/2014, 03:20
... SSVGL Ab N1 9C Ab N1 9C N18S Ab N1 9C MD22VH Ab N1 9C N18S MD22VH 250 Oligomerization and secretion of AChE and BChE Fig Cellular and secreted activities produced by human AChE, BChE and mutants ... secretion for Aa1 9C, increased it for Ba1 9C, and decreased it for Ab1 9C and Bb1 9C (Fig 2) The fact that the cellular activity was unchanged or decreased, whereas secretion was decreased, indicates ... probably reflects their subtly distinct functions, associated with the respective roles of AChE and BChE in synaptic and nonsynaptic contexts Experimental procedures Mutations and constructs The coding...
- 15
- 446
- 0
Báo cáo khoa học: ` Inhibition of human ether a go-go potassium channels by 2+ Ca ⁄calmodulin binding to the cytosolic N- and C-termini potx
Ngày tải lên :
07/03/2014, 12:20
... interaction underlies Ca2+-calmodulin modulation of cyclic nucleotide-gated channels J Neurosci 23, 8167–8175 Trudeau MC & Zagotta WN (2002) Mechanism of calcium ⁄ calmodulin inhibition of rod cyclic ... Adelman JP & Maylie J (1999) Domains responsible for constitutive and Ca2+–dependent interactions between calmodulin and small conductance Ca2+-activated potassium channels J Neurosci 19, 8830–8838 ... TMR-MCGS(H)6-hCaM to the indicated constructs in the absence and presence of 25 lM free Ca2+ determined by confocal FCS ND ¼ not determined KD (nM+) Constructs Short name +Ca2+ –Ca2 GST control GST-hEAG(1–206)...
- 13
- 500
- 0
Báo cáo khoa học: Amino acids at the N- and C-termini of human glutamate carboxypeptidase II are required for enzymatic activity and proper folding pptx
Ngày tải lên :
07/03/2014, 15:20
... ACACTCGAGAGATCTGCAAATGAATATG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC AAACTCGAGAGATCTAAATCCTCCAATGAAGC CACCTCGAGTTATTATAGCTCAAACACCATCC ... ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTTTTCAGCTTGCAAAGCAA ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTAAGACTCATCCCAACTAC ATTCTCGAGTCATTAGGCTACTTCACTCAAAG AAAAGATCTGGATATGAAAATGTTTCGG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG ... AAACTCGAGAGATCTAAATCCTCCAATGAAGC ATTCTCGAGTCATTATGCAACATAAATCTGTCTCTT AAACTCGAGAGATCTAAATCCTCCAATGAAGC AAACTCGAGTTATTATTCAATATCAAACAGAG AAAAGATCTAAAGCATTTTTGGATGAATTG ATTCTCGAGTCATTAGGCTACTTCACTCAAAG...
- 9
- 414
- 0
Secure Coding in C and C++ pdf
Ngày tải lên :
08/03/2014, 11:20
... course of events 31 Leaking Containers in C+ + In C+ +, standard containers that contain pointers not delete the objects to which the pointers refer vector pic; pic.push_back( new Circle ... *> pic; … releaseItems( pic ); 33 Dueling Containers in C+ + vector pic; pic.push_back( new Circle ); pic.push_back( new Triangle ); pic.push_back( new Square ); … list picture; ... a particular context – pointer arithmetic – pointer copying – etc 36 Reference Counted Smart Pointers Reference counted smart pointers maintain a reference count for the object to which they...
- 135
- 4.6K
- 0
Chapter 1 – Introduction to Computers and C++ Programming pot
Ngày tải lên :
10/03/2014, 06:20
... Date objects, time objects, paycheck objects, invoice objects, audio objects, video objects, file objects, record objects, etc • Any noun can be represented as an object – More understandable, ... pieces called classes and functions • C+ + standard library – Rich collections of existing classes and functions • “Building block approach” to creating programs – “Software reuse” © 2003 Prentice ... reserved 21 1.10 Visual Basic, Visual C+ + and C# • C# – Anders Hejlsberg and Scott Wiltamuth (Microsoft) – Designed specifically for NET platform – Roots in C, C+ + and Java • Easy migration to NET...
- 61
- 1.5K
- 0
Linq and C# 3.0 docx
Ngày tải lên :
14/03/2014, 20:20
... tracking • Object identity • Currently load context of objects can be saved, discarded or accepted • 28 JUNI 2006 | © CLASS-A E ntityS et uses lazy loading of related collections into context ... brain” }; • 28 JUNI 2006 | © CLASS-A Name of field/property must be specified 40 C# 3.0: Collection initializers • Compact initialization of collections • Collection must implement ICollection List ... this.OnPropertyChanged("Name"); } } } } 28 JUNI 2006 | © CLASS-A 24 Contexts of data objects • Objects returned from Linq to S queries are QL materialized into DataContext • DataContext class handles • Change...
- 58
- 424
- 1
apress metro revealed, building windows 8 apps with xaml and c# (2012)
Ngày tải lên :
15/03/2014, 09:34
... project to MetroGrocer, and click the OK button to create the project Visual Studio will create and populate the project ■■Tip Visual Studio includes some basic templates for C# Metro applications ... ... I’ll discuss the StandardStyles.xaml...
- 98
- 1.7K
- 0
apress windows 8 apps revealed, using xaml and c# (2012)
Ngày tải lên :
15/03/2014, 09:36
... project from Apress.com Creating the Project To create the example project, start Visual Studio and select File ➤ New Project In the New Project dialog, select Visual C# from the Templates section ... side You can adapt to these layouts using just C# code or a mix of code and XAML I show you both approaches Chapter 5: App Life Cycle and Contracts Windows applies a very specific life-cycle model ... = ...
- 130
- 1.4K
- 0
Quantification of vitamin e and ç oryzanol components in RiceGermandBran
Ngày tải lên :
15/03/2014, 15:33
... Rogers, E J. ; Rice, S M.; Nicolosi, R J. ; Carpenter, D R.; McClelland, C A.; Romanczyk, L J Identification and quantitation of γ-oryzanol components and simultaneous assessment of tocols in rice bran ... Dietary carcinogens and anticarcinogens Oxygen radicals and degenerative diseases Science 1983, 221, 12561264 (9) Lipid Soluble Antioxidants: Biochemistry and Clinical Applications; Ong, A S H., Packer, ... mass spectrometry; API-ES, atmospheric pressure interface-electrospray; ICC, ion-charge control; CID, collision-induced dissociation; frag, fragment LITERATURE CITED (1) Esterbauer, H.; Eckl, P.;...
- 6
- 649
- 1
Programming Embedded Systems in C and C ++ docx
Ngày tải lên :
17/03/2014, 13:20
... model," and -1 for "the target is an 80186 processor." Here are the actual commands: bcc -c -v -ml -1 led .c bcc -c -v -ml -1 blink .c Of course, these commands will work only if the bcc.exe program ... decrement -and- test cycles */ unsigned long nCycles = nMilliseconds * CYCLES_PER_MS; while (nCycles ); } /* delay() */ The hardware-specific constant CYCLES_PER_MS represents the number of decrement -and- test ... in C and C+ + Communication between the GDB frontend and the debug monitor is byte-oriented and designed for transmission over a serial connection The command format and some of the major commands...
- 187
- 924
- 1