plugging in to the grid with a full scale pv system

Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt

Chapter 052. Approach to the Patient with a Skin Disorder (Part 1) ppt

... 52-3) and to formulate a differential diagnosis (Table 52-4) For instance, the finding of scaling papules (present in patients with psoriasis or atopic dermatitis) places the patient in a different ... lesions If the examiner focuses on linear erosions overlying an area of erythema and scaling, he or she may incorrectly assume that the erosion is the primary lesion and the redness and scale are secondary, ... >0.5 cm in diameter Wheal: A raised, erythematous, edematous papule or plaque, usually representing short-lived vasodilatation and vasopermeability Telangiectasia: A dilated, superficial blood vessel...

Ngày tải lên: 06/07/2014, 20:20

5 414 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 2) potx

Chapter 052. Approach to the Patient with a Skin Disorder (Part 2) potx

... delicate, wrinkled lesions (i.e., epidermal atrophy) Scar: A change in the skin secondary to trauma or inflammation Sites may be erythematous, hypopigmented, or hyperpigmented depending on their age ... character Sites on hair-bearing areas may be characterized by destruction of hair follicles Table 52-3 Common Dermatologic Terms Alopecia: Hair loss; it may be partial or complete Annular: Ring-shaped ... Pruritus: A sensation that elicits the desire to scratch Pruritus is often the predominant symptom of inflammatory skin diseases (e.g., atopic dermatitis, allergic contact dermatitis); it is also...

Ngày tải lên: 06/07/2014, 20:20

5 334 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 4) doc

Chapter 052. Approach to the Patient with a Skin Disorder (Part 4) doc

... primary and secondary lesions, the shape of individual lesions, and the arrangement of the lesions An ideal skin examination includes evaluation of the skin, hair, and nails as well as the mucous ... examining the skin it is usually advisable to assess the patient before taking an extensive history This way, the entire cutaneous surface is sure to be evaluated, and objective findings can ... hospitalized patient with a generalized erythematous exanthem is more likely to have a drug eruption than is a patient with a similar rash limited to the sun-exposed portions of the face Once the distribution...

Ngày tải lên: 06/07/2014, 20:20

5 414 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 5) pptx

Chapter 052. Approach to the Patient with a Skin Disorder (Part 5) pptx

... A D The distribution of some common dermatologic diseases and lesions Figure 52-7 Psoriasis This papulosquamous skin disease is characterized by small and large erythematous papules and plaques ... skin disease is characterized by small and large erythematous papules and plaques with overlying adherent silvery scale Figure 52-8 ...

Ngày tải lên: 06/07/2014, 20:20

5 321 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 6) pdf

Chapter 052. Approach to the Patient with a Skin Disorder (Part 6) pdf

... contact (Fig 52-10) or primary irritant dermatitis In contrast, lesions with a generalized arrangement are common and suggest a systemic etiology Figure 52-9 Erythema multiforme This ... eruption is characterized by multiple erythematous plaques with a target or iris morphology It usually represents a hypersensitivity reaction to drugs (e.g., sulfonylamides) or infections (e.g., ... reaction to drugs (e.g., sulfonylamides) or infections (e.g., HSV) (Courtesy of the Yale Resident's Slide Collection; with permission.) Figure 52-10 ...

Ngày tải lên: 06/07/2014, 20:20

5 319 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 7) ppt

Chapter 052. Approach to the Patient with a Skin Disorder (Part 7) ppt

... superficial anatomic structures in selected areas of the body In this procedure, a small area of skin is anesthetized with 1% lidocaine with or without epinephrine The skin lesion in question can be ... melanoma, atopy, psoriasis, or acne) 10 Social, sexual, or travel history as relevant to the patient DIAGNOSTIC TECHNIQUES Many skin diseases can be diagnosed on gross clinical appearance, but ... relatively simple diagnostic procedures can yield valuable information In most instances, they can be performed at the bedside with a minimum of equipment Skin Biopsy A skin biopsy is a straightforward...

Ngày tải lên: 06/07/2014, 20:20

5 398 0
Chapter 052. Approach to the Patient with a Skin Disorder (Part 8) pptx

Chapter 052. Approach to the Patient with a Skin Disorder (Part 8) pptx

... noting the amount of blanching that occurs Granulomas often have an opaque to transparent, brown-pink "apple jelly" appearance on diascopy Figure 52-11 Urticaria Discrete and confluent, edematous, ... edematous, erythematous papules and plaques are characteristic of this whealing eruption Wood's Light A Wood's lamp generates 360-nm ultraviolet (or "black") light that can be used to aid the evaluation ... of certain skin disorders For example, a Wood's lamp will cause erythrasma (a superficial, intertriginous infection caused by Corynebacterium minutissimum) to show a characteristic coral pink color,...

Ngày tải lên: 06/07/2014, 20:20

5 367 0
Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf

Báo cáo hóa học: " Research Article Design and Implementation of a Generic Energy-Harvesting Framework Applied to the Evaluation of a Large-Scale Electronic Shelf-Labeling Wireless Sensor Network" pdf

... (voltage drain drain) to the USB power of the board The ADC (analog -to- digital converter) and DAC (digital -to- analog converter) lines are connected to DAC1 and ADC4 of the EE’s MSP430 Next, the ... is the farad; farad = coulomb per volt; typical capacitances are measured in microfarads or picofarads) 5.2.1 The Virtual Capacitor To implement the law of Coulomb, a TinyOS application was developed ... know that the capacitance (stated in terms of the amount of charge (Q) stored at a given voltage drop (across the capacitor)) of a capacitor is given by (1) (Note that: the SI unit of capacitance...

Ngày tải lên: 21/06/2014, 11:20

12 524 1
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot

... TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA ... Ala forward Phe700 fi Ala reverse Phe718 fi Ala forward Phe718 fi Ala reverse Val736 fi Ala forward Val736 fi Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC ... TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC GCAATACTCAGAGCCTTGGCGTCAGGCTCCAGAGC TGTCGGCACCTCCAGGCTATCCCTGTGGCACCA TGGTGCCACAGGGATAGCCTGGAGGTGCCGACA...

Ngày tải lên: 16/03/2014, 12:20

15 337 0
Báo cáo lâm nghiệp: "Rationalization of the performance of a mobile off-road system working in the forest environment with respect to its emission load" doc

Báo cáo lâm nghiệp: "Rationalization of the performance of a mobile off-road system working in the forest environment with respect to its emission load" doc

... (material flows processed by the logging and transport systems), resulting from the changed performance of the system, not always cause a change in power and material consumption and thus a change ... used systems Factors affecting specific resource and material consumption: – The change in all assemblies of logging and transport systems affecting the consumption of resources, material and/or ... labour is not directly proportional to an increase in the design performance; – The changed investment intensity of logging and transport systems is not proportional to the change in performance...

Ngày tải lên: 07/08/2014, 10:21

6 342 0
A Sneaky Backdoor In to Google FAST With Free Press Releases!

A Sneaky Backdoor In to Google FAST With Free Press Releases!

... originally wanted to make the main keyword “Soap Making” instead of “Soap Making Secrets” because soap making had over 22,000 searches the previous month… But I left it alone and wanted to see ... also all the insider tricks, tips and techniques that the experts use to make advanced, hand-crafted soaps Based on years of research Dave doesn't leave the reader hanging "Learning how to make ... release at PR-WEB you have a “Headline Section” a “Summary Section” and a “Body Section” The headline: Breakthrough Soap Making Secrets The Summary: Dave Cushion says: "These are Soap Making...

Ngày tải lên: 23/10/2013, 01:15

8 384 0
Tài liệu A Sneaky Backdoor In to Google FAST With Free Press Releases pptx

Tài liệu A Sneaky Backdoor In to Google FAST With Free Press Releases pptx

... originally wanted to make the main keyword “Soap Making” instead of “Soap Making Secrets” because soap making had over 22,000 searches the previous month… But I left it alone and wanted to see ... also all the insider tricks, tips and techniques that the experts use to make advanced, hand-crafted soaps Based on years of research Dave doesn't leave the reader hanging "Learning how to make ... release at PR-WEB you have a “Headline Section” a “Summary Section” and a “Body Section” The headline: Breakthrough Soap Making Secrets The Summary: Dave Cushion says: "These are Soap Making...

Ngày tải lên: 24/01/2014, 20:20

8 310 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

... eGFP, the 5¢ interface is GGTACCG CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG ... SLC2 2A1 6h, the 5¢ interface is GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry ... 5¢ interface between cDNA and pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For pEBTetD...

Ngày tải lên: 23/03/2014, 09:21

8 331 0
báo cáo khoa học: " The NIHR collaboration for leadership in applied health research and care (CLAHRC) for Greater Manchester: combining empirical, theoretical and experiential evidence to design and evaluate a large-scale implementation strategy" pptx

báo cáo khoa học: " The NIHR collaboration for leadership in applied health research and care (CLAHRC) for Greater Manchester: combining empirical, theoretical and experiential evidence to design and evaluate a large-scale implementation strategy" pptx

... implementation team and NHS organizations involved in the CLAHRC activities, and act as the main facilitators of change in the field KTAs are supported by an academic lead, who provides the link to the ... situation, bring about change, and learn how to improve their actions Having a similar need to translate research findings into practice, the KTAs are researching together their experiences of facilitating ... say, there are many tensions inherent within the implementation approach we are taking, e.g., balancing local responsiveness and flexibility with maintaining an evidence-based approach to change...

Ngày tải lên: 10/08/2014, 11:20

12 295 0
Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf

Báo cáo y học: "Reconstruction of the urethra with a Surgisis onlay patch in urethral reconstructive surgery: two case reports" pdf

... drafting the manuscript and in the review of the literature and in performing the clinical follow-up HG was involved in drafting the manuscript and in the review of the literature SH participated ... the final draft Do you have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach ... participated in the surgery and was involved in the clinical follow-up JR participated in the surgery, was involved in the clinical follow-up and supervised this report All authors read and approved the...

Ngày tải lên: 11/08/2014, 17:21

4 293 0
Báo cáo y học: "Parenting-by-gender interactions in child psychopathology: attempting to address inconsistencies with a Canadian national database" docx

Báo cáo y học: "Parenting-by-gender interactions in child psychopathology: attempting to address inconsistencies with a Canadian national database" docx

... logical to measure the mechanism being used to explain the moderated relationship at the level of theory and using that as the moderator variable We are certainly not suggesting that researchers away ... hostileineffective parenting, and parental consistency remained significant predictors in the same direction Additionally, Table Analysis of attrition comparing retained participants with complete data (n = ... variables using Generalized Estimating Equations (GEE) [47,48] In other words, both predictor variables and outcome variables are measured at each data collection cycle and incorporated into the...

Ngày tải lên: 13/08/2014, 18:21

13 340 0
Báo cáo y học: " Gunshot bullet embolus with pellet migration from the left brachiocephalic vein to the right ventricle: a case report Nicholas Greaves" pptx

Báo cáo y học: " Gunshot bullet embolus with pellet migration from the left brachiocephalic vein to the right ventricle: a case report Nicholas Greaves" pptx

... vetriculoseptal defect thereby excluding a paradoxical embolus The patient remained asymptomatic throughout the admission and was discharged after days Out-patient review with x-rays at weeks and months after ... complications of retained intravascular emboli include claudication, parasthesiae, pain, pleural effusion, pericardial effusion, pulmonary abscess, pulmonary infarction, gangrene, endocarditis, arrhythmias, ... (pellet) artefact in the right atrium Note also the pellets in the left arm ventricular and valvular function with the pellet still in the right ventricle It showed there was no patent foramen ovale...

Ngày tải lên: 13/08/2014, 23:20

3 181 0
Báo cáo hóa học   research article a fixed point approach to the stability of a quadratic functional equation in c∗  alg

Báo cáo hóa học research article a fixed point approach to the stability of a quadratic functional equation in c∗ alg

... in C∗ -algebras A systematic study of fixed point theorems in nonlinear analysis is due to Hyers et al 30 and Isac and Rassias 13 Solutions of 1.8 Theorem 2.1 Let X be a linear space If a mapping ... Mathematical Analysis and Applications, vol 158, no 1, pp 106–113, 1991 20 Th M Rassias, “On the stability of functional equations in Banach spaces,” Journal of Mathematical Analysis and Applications, ... in Nonlinear Differential Equations and Their Applications, Birkh¨auser, Boston, Mass, USA, 1998 24 S.-M Jung, Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic...

Ngày tải lên: 20/12/2015, 08:14

10 296 0
w