picture there is a fire engine with some firefighters who are trying to stop a big fire
There is a Reaper ... pptx
Ngày tải lên :
15/03/2014, 17:20
... he said "The realities I knew no longer exist, and I am damp and cold All about me is a sense of gloom and dejection It is an apprehension—an emanation—so deep and real as to be almost a tangible ... is a happy man who lives in San Francisco and owns a tattoo shop One night an angry demon tries to bite his head off before he's saved by a stranger The demon infected Spyder with something awful ... horror "There is something coming toward me," he said "A beast—of brutish foulness! Beast is too inadequate a term to describe it, but I know no words to tell its form It is an intangible and evasive—thing—but...
- 10
- 394
- 0
There is a Reaper ... docx
Ngày tải lên :
29/03/2014, 00:20
... he said "The realities I knew no longer exist, and I am damp and cold All about me is a sense of gloom and dejection It is an apprehension—an emanation—so deep and real as to be almost a tangible ... is a happy man who lives in San Francisco and owns a tattoo shop One night an angry demon tries to bite his head off before he's saved by a stranger The demon infected Spyder with something awful ... horror "There is something coming toward me," he said "A beast—of brutish foulness! Beast is too inadequate a term to describe it, but I know no words to tell its form It is an intangible and evasive—thing—but...
- 11
- 318
- 0
Báo cáo y học: "Road trips and resources: there is a better way" pot
Ngày tải lên :
12/08/2014, 18:20
... patients be transported with a critical care nurse, a physician and a respiratory therapist (if the patient is mechanically ventilated) Extra escort personnel are required as necessary to transport ... extra 21 to ready This time was direct time away from patient care If the number of patients in this study were greater, the CarePorter group may in fact have demonstrated a statistical advantage ... quickly and overall the CarePorter made the transport easier Since intrahospital transport is a source of angst among staff, anything that can reasonably improve this process is warranted Since all...
- 7
- 329
- 0
Leadership in organizations there is a difference between leaders and managers by david i bertocci
Ngày tải lên :
01/04/2017, 09:41
... Charisma and Vision Charismatic Leadership in Crises Examples of Charismatic Leaders Summary 43 44 44 45 45 46 Transactional and Transformational Leadership Transactional Leadership Transformational ... what makes a leader and what exactly leadership is are also changing This is what makes a study of leaders and leadership so exciting and challenging Can anyone deny that Rudy Giuliani displayed ... Managers Some leaders are very good managers and some managers are very good leaders However, management typically reflect different functions in an organization A manager in a formal organization...
- 135
- 697
- 0
Unit 2: Lets learn some more(Who are they? They are teachers)
Ngày tải lên :
02/06/2015, 19:00
... tranh : Who is ? she he Sheis a He farmer nurse teacher cook EM khoANH TRòN MộT Từ KHáC LOạI : a cook a teacher shopkeepers a nurse Chú ý: a nurse students police officers nurses a farmer taxi ... farmer taxi drivers Monday, November 30th 2009 Unit 2: Who are they? Theyre teachers Who are they? Theyre + danh từ số nhiều Theyre = They are Who are they? teachers farmers nurses students cooks ... farmers nurses students cooks Theyreshopkeepers Monday, November 30th 2009 Unit 2: taxi drivers es co rs u ok nLuật chơi: Em chọn viết giấy danh từ s nghề nghiệp Nếu có từ giống sh với từ mà côpolice...
- 7
- 239
- 1
Older adults with history of falls are unable to perform walking and prehension movements simultaneously
Ngày tải lên :
25/08/2016, 22:37
... stable base with obstacles at short distance, UB: unstable base, ULD: unstable base with obstacles at long distance, USD: unstable base with obstacles at short distance) Fig Mean and standard ... Biomechanics and motor control of human movement Hoboken, New Jersey: Wiley 384 Yamada M, Aoyama T, Nakamura M, Tanaka B, Nagai K, Tatematsu N, Uemura K, Nakamura T, Tsukoyama T, Tchihaski N ... (2012) Local dynamic stability and variability of gait are associated with fall history in elderly subjects Gait Posture 36:1050–1056 Uemura K, Yamada M, Nagai K, Tanaka B, Mori S, Ichihashi N (2012)...
- 12
- 315
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
Ngày tải lên :
03/11/2012, 10:52
... immunocytochemically revealed that Vgf immunoreactive material in spinal cord motorneurons is already decreased in ~75 day old asymptomatic SOD-1 G9 3A- SOD1 ALS mice and continue to decrease as a function ... complex was precipitated with 100 µl of goat anti rabbit IgG and 10 µl of normal rabbit serum (Peninsula Laboratories Inc., San Carlos, CA) dissolved in RIA buffer After incubating at room temperature ... culture medium was replaced again days thereafter For excitotoxicity studies ~ 8-day-old spinal cord cultures were challenged with the glutamate receptor agonists AMPA (5 µM) and NMDA (20 µM) for...
- 8
- 499
- 0
Ecological performance of a generalized irreversible Carnot heat engine with complex heat transfer law
Ngày tải lên :
05/09/2013, 15:28
... finite The total heat transfer surface area ( F ) of the two heat exchangers is assumed to be a constant: F = F1 + F2 (3) There exists a constant rate of bypass heat leakage ( q ) from the heat source ... α is the overall heat transfer coefficient and F1 is the heat-transfer surface area of the hightemperature-side heat exchanger , β is the overall heat transfer coefficient and F2 is the heat-transfer ... Carnot heat engine with linear phenomenological heat transfer law [54, 57] If n = , they are the results of irreversible Carnot heat engine with radiative heat transfer law [55, 57] (2) Equations...
- 14
- 534
- 0
Getting Started With ASP.NET ASP.NET is a new and powerful technology for writing dynamic web pages.
Ngày tải lên :
06/11/2013, 00:15
... support via something known as the Java Virtual Machine (JVM), and there are several standard and non-standard tags that are used to add Java applets to a web page These tags tell ... download time is faster than Java, and also you don't have to worry about integrating different languages into the page, as Curl is capable of providing the same features as both Java and JavaScript ... NT and many Unix versions, and it can be built as an Apache module and as a binary that can run as a CGI When built as an Apache module, PHP is especially speedy A downside is that you have to...
- 792
- 596
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
Ngày tải lên :
15/02/2014, 01:20
... Mori K, Hieda N, Yamanishi M, Shibata N & Toraya T (2005) Crystallization and preliminary X-ray analysis of molecular chaperone-like diol dehydratasereactivating factor in ADP-bound and nucleotide-free ... release of adenine-lacking cobalamins, such as CN-Cbl and damaged cofactor The fact that the relative efficiencies of metal ions for the reactivation are not always correlated with the ATPase activity ... reactivating factor while it exists as an active holoenzyme The glycerol dehydratase-reactivating factor reactivates the inactivated hologlycerol dehydratase in a similar manner Both dehydratase-reactivating...
- 13
- 620
- 0
Tài liệu Where There Is No Psychiatrist A Mental Health Care Manual ppt
Ngày tải lên :
15/02/2014, 02:20
... almost no social life … I didn’t know what to and I was too scared to see a psychiatrist … after all, I am not a mental case.” A 24-year-old woman with panic attacks and phobia “I was only 17 when ... choking sensation and felt his heart beating hard His father had a heart complaint and Ravi became worried that he had a heart problem too This made him scared and fearful The doctor sent him ... workers are likely to have patience with this list The problem-oriented approach that I have taken in this manual is to begin with common or important clinical presentations that have a mental health...
- 290
- 1.3K
- 0
Tài liệu Báo cáo khoa học: Helicobacter pylori acidic stress response factor HP1286 is a YceI homolog with new binding specificity pdf
Ngày tải lên :
16/02/2014, 14:20
... that is, if Ala25 of chain A is close to Asn77 of chain B, then Asn77 of chain A is close to Ala25 of chain B Chain A Chain B Hydrogen bonds Ala25 Asn77, Arg80 Asn26 His35, Arg80, Asn39 AlaO–ArgNH1 ... diffracts to a ˚ Table Statistics on data collection and refinement A wavelength of 0.8726 A was used Rotations of 1° were performed The Ramachandran plot was calculated using RAMPAGE X-ray data Space ... Residues are considered to be in contact when at least one atom of a residue of chain A is at a dis˚ tance shorter than 4.0 A from an atom of a residue of chain B When a hydrogen bond is formed,...
- 10
- 768
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
Ngày tải lên :
19/02/2014, 05:20
... GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG ... GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... GCGAAGCTTTTATTTGTCATCGTCATCCTTGTAGTCTTTCCCAGCCTGTTGGGCCTG GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT...
- 14
- 517
- 0
Tài liệu Báo cáo khoa học: KIPase activity is a novel caspase-like activity associated with cell proliferation doc
Ngày tải lên :
19/02/2014, 13:20
... for caspases and 7; Ac-YVAD-AMC is a substrate for caspase 1; Ac-IETD-AMC is a substrate for caspase and 10; Ac-LEHD-AMC is a substrate for caspases 2, 4, and Ac-DVPD-AMC, Ac-DPSD-AMC and Ac-ESQD-AMC ... cleavage assays are a valuable means to follow enzyme activities, not all substrates are recognized by caspases in this manner It has been previously shown that caspases can cleave p27KIP1 at ... fluorogenic assays performed in duplicate The preferred substrate (bar A) for each was as follows: caspase 1, WEHD-AMC; caspase 2, VDVADAMC; caspase 3, DEVD-AMC; caspase 4, WEHD-AMC; caspase 5, WEHD-AMC,...
- 8
- 442
- 0
Tài liệu Báo cáo khoa học: Hu-K4 is a ubiquitously expressed type 2 transmembrane protein associated with the endoplasmic reticulum ppt
Ngày tải lên :
19/02/2014, 17:20
... 4¢ 4¢ 5¢ A 105 75 50 35 + - + + Weak Weak > 54 aa aa T C C T G Weak Weak Adequate Weak Adequate aa 58 aa 13 aa 33 aa 31 aa Adequate Adequate aa 24 aa ATG ATG ATG ATG ATG C B αHu-K4 + PIS Peptide ... retrieval signal is missing The human phospholipases D1 and D2 are mainly associated with the plasma membrane or with the membranes of intracellular organelles although they lack a transmembrane ... poly (A) tail (Fig 3A) Both are not identical to the most often used signal AAT AAA which is found in 65% of human mRNAs, but especially variants with a single pyrimidine substitution like AATAAC also...
- 9
- 518
- 0
"Shiloh" as Seen by a Private Soldier With Some Personal Reminiscences pptx
Ngày tải lên :
16/03/2014, 01:20
... a Private Soldier, by Warren Olney was such, that he did not make more than half the distance, and had to go into camp for the night Saturday was a reasonably pleasant day, but General Johnston's ... miles off, was camped General Lew Wallace's division It was so far away as not to be in easy supporting distance On April 1st, our division was marched to an open field, and there carefully reviewed ... in some respects, constituted a little aristocracy We had had a small tent to ourselves, and the socialistic grayback, as yet, had not crawled therein Now, we were required to share our tent with...
- 19
- 253
- 0
Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx
Ngày tải lên :
16/03/2014, 13:20
... on SDS ⁄ PAGE and their methylation assessed by autoradiography A parallel gel was analyzed by Coomassie Brilliant Blue staining Lane 6: bacterial 6xHis-Ki-1 ⁄ 57 methylated in vitro was run out ... cerevisiae strain L40 A human fetal brain cDNA library (Clontech, Palo Alto, CA) expressing GAL4 activation domain (AD) fusion proteins was cotransfected with each one of these three recombinant ... Watanabe K-I, Nakagawa T, Miyazaki K, Takahashi M & Nakagawara A (2003) Function of p73, FEBS Journal 273 (2006) 3946–3961 ª 2006 The Authors Journal compilation ª 2006 FEBS 3959 Functional association...
- 16
- 367
- 0
Báo cáo khoa học: EmbR, a regulatory protein with ATPase activity, is a substrate of multiple serine⁄threonine kinases and phosphatase in Mycobacterium tuberculosis doc
Ngày tải lên :
16/03/2014, 14:20
... suggested as one of the targets for a signal transduction pathway mediated by PknA and PknB If so, this pathway could link cell division and peptidoglycan synthesis with arabinogalactan synthesis, another ... cell division Eur J Biochem 269, 1078–1085 Sharma K, Chandra H, Gupta PK, Pathak M, Narayan A, Meena LS, D’Souza RC, Chopra P, Ramachandran S & Singh Y (2004) PknH, a transmembrane Hank’s type ... were resolved by SDS ⁄ PAGE and the loss of labeling was visualized by autoradiography ATPase activity measurements The malachite green ATPase assay The reaction buffer contained 10 lL of 10· TMD...
- 11
- 402
- 0
Báo cáo khoa học: Human retinol dehydrogenase 13 (RDH13) is a mitochondrial short-chain dehydrogenase⁄reductase with a retinaldehyde reductase activity pdf
Ngày tải lên :
23/03/2014, 07:20
... 4) Activity assays showed that purified RDH13–His6 was indeed active towards all-trans-retinaldehyde and appeared to prefer NADPH to NADH as a cofactor, because the conversion of lm all-trans-retinaldehyde ... sufficient for antiserum production Rabbit polyclonal antiserum against purified RDH13–His6 was raised at Alpha Diagnostics International Inc (San Antonio, TX, USA) 144 For western blot analysis of RDH13 ... Ni2+-nitrilotriacetic acid metal affinity resin (Qiagen Inc., Valencia, CA, USA), according to the manufacturer’s protocol The protein appeared to be inactive, but was obtained in quantities sufficient for antiserum...
- 10
- 674
- 0