... pH Because most of the chemical and biochemical reaction are influenced by the pH it is of great practical importance The adverse affect of most of the acids appear below and of alkalis above ... reserved International Journal of Energy and Environment (IJEE), Volume 1, Issue 5, 2010, pp.823-832 Table Physicochemical properties of river Ganga at Assi Ghat (Avg of two years i.e Jan 2006-2008) ... Foundation All rights reserved 827 Table Physicochemical properties of river Ganga at Shiwala Ghat (Avg of two years i.e Jan 2006-2008) International Journal of Energy and Environment (IJEE), Volume...
Ngày tải lên: 05/09/2013, 16:11
... morphology of the carbon sup- Fig Study of the morphology of the original (non-oxidized) carbon supports: (a) SEM image of CNF; (b) TEM image of CNF; (c) TEM image of CMK-3; and (d) SEM image of Vulcan ... lowtemperature fuel cells The use of these non-conventional carbon materials as support allowed studying the influence of support properties on the physicochemical properties of catalysts Thus, the main ... NcTb0.5 Vulcan NcTb2 Fig Effect of the surface chemistry of the support on catalyst properties: relationship between the total number of surface oxygen groups of the support (CO + CO2 desorbed...
Ngày tải lên: 23/04/2014, 22:47
Handbook of the physicochemical properties of the elements g v samsonov (auth ), g v samsonov (eds )
... Section of the Institute of Problems in the Study of Materials, Academy of Sciences UkrSSR and of the Metal Reduction Laboratory of the Institute of the Physicochemical Principles of Processing of ... Wavelengths of M-Series • Wavelengths of N -Series Radii of the Main Maxima of Outer Orbitals of Atoms Radii of the Main Maxima of Outer Orbitals of Ions Atomic ... by the lack of a single collection of reliable data on the properties of the elements vii viii PREFACE The handbook was compiled by a large group of authors consisting of the staffs of the Refractory...
Ngày tải lên: 02/12/2016, 12:44
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig ... of CTD of /11 CI The ribbons, helices and tubes represent a-helices, b-sheets and loops, respectively (D) Schematic representation of NTD of /11 CI; notation as in (C) (E) Far-UV CD-spectra of ... masses (kDa) are shown to the right of the gel (B) Autoradiogram of the gel shift assay shows the binding of varying concentrations (0.2–2 lM) of CI to a fixed amount of O1 DNA mix ( 0.1 nM 32P-labeled...
Ngày tải lên: 07/03/2014, 00:20
Properties of Convolution
... operations Chapter 7- Properties of Convolution 127 2.0 a Original signal Amplitude 1.0 0.0 -1.0 FIGURE 7-3 Example of calculus-like operations The signal in (b) is the first difference of the signal ... curve of the form: sin(x)/(x) , is used to separate one band of frequencies from another c Sinc 0.3 Amplitude Amplitude 0.3 0.2 0.1 0.0 -0.1 -20 -15 -10 Sample number Chapter 7- Properties of Convolution ... affect any of the output signal values As shown by the examples in Fig 7-6, the impulse response of a causal system must have a value of zero for all negative numbered samples Think of this from...
Ngày tải lên: 13/09/2012, 09:49
FOAMING PROPERTIES OF PROTEINS.pdf
... summary of the independent parameters the modified foaming apparatus FOAMING PROPER TIES used far experi- Nature Fixed Diameter Porosity Volume Volume Mass of of sparging disc of sparging disc of ... such methods should provide a measure of the physicochemical properties related to foaming A standard method for testing foaming properties based on the method of Foulk and Miller (1931) was proposed ... = Tw Did = = percent of gas initially in 70 ml of foam (gas Flow Rate) - ml/min of nitrogen time to fill the column with foam volume of liquid in the foam initially volume of liquid drained from...
Ngày tải lên: 16/12/2012, 15:10
Thermal properties of the vernacular buildings envelopes: the case of the "Sassi di Matera" and "Trulli di Alberobello
... University of Bari in 1979 University Researcher at the of Engines and Energy Institute of the Faculty of Engineering at the University of Bari from 1983 to 1987 Associate professor of Technical ... measure of conductance The analyses, done in the laboratory of Technical Physics of the Polytechnic of Bari, were performed on some samples of calcarenite sandstone and calcareous stone of Fasano ... typologies of building wall: a wall in blocks of calcarenite sandstone assembled with mortar, typical of the constructions of "Sassi of Matera," and a masonry made with dry calcareous stones of Fasano,...
Ngày tải lên: 05/09/2013, 14:58
Effects of time of heatsetting on the tensile properties of ingeo™ poly (lactic acid) (PLA) fabric
... Figure Effect of time of heatsetting on the linearity of load extension in weft direction of knitted Ingeo™ Poly (lactic acid) Figure Mean effect of time of heatsetting on the linearity of load extension ... Increasing time of heatsetting had effect on tensile properties of PLA at varying times of 30s to 90s at temperature of 130°C Optimum effect on tensile properties occurred at times of 30 – 45s PLA ... [PLA] Figure Mean [Ā] of effect of time of heatsetting on the tensile extension EM [%] of Ingeo™ Poly (lactic acid) 3.2 Linearity of load extension curve LT [-] The linearity of load extension curve...
Ngày tải lên: 05/09/2013, 16:10
Properties of American Derivative Securities
... owner of the derivative security should exercise it If he does not, then the seller of the security can immediately consume f Vk ! , + r IE Vk+1jF k ! and still maintain the hedge 6.2 Proofs of ... maintain the hedge 6.2 Proofs of the Properties Let fGk gn=0 be a sequence of non-negative random variables such that each Gk is F k -measurable k Define Tk to be the set of all stopping times satisfying ... Lemma 2.18 Proof: Take Vk Gk for every k Tk to be the constant k Lemma 2.19 The process f1 + r,k Vk gn=0 is a supermartingale k Proof: Let attain the maximum in the definition of Vk+1 , i.e.,...
Ngày tải lên: 18/10/2013, 03:20
Static properties of granular materials Philippe Claudin
... a series of captors), and are thus much noisier 250 Static properties of granular materials F r p h z Fig 14.13 Sketch of the experimental set-up of Reydellet et al for the measure of the pressure ... focused on the quasistatic rheology of a granular system, so why is all of this related to the description of its statics? As a matter of fact, the static properties of the studied sample are responsible ... horizontal position of the apex of the pile – also, changing the sign of x changes that of the shear σx z More generally, the stress state of the jammed grain packing is assumed to be of the form σx...
Ngày tải lên: 01/11/2013, 08:20
Tài liệu Nature and Properties of Micro-organisms doc
... Formaldehyde increases infectivity Viruses DNA or RNA Shell of protein (capsid) surrounding nucleic acid Classification on basis of nucleic acid DNA viruses: eg Herpes simplex virus (HSV) ... body Varicella zoster virus (VZV) VZV: Chickenpox VZV: Shingles Re-activation of latent infection Suppression of cell mediated immunity Bacteria Unicellular, DNA and RNA Binary No prokaryotes ... (transfer of plasmid DNA) Important bacterial products 1: extracellular polysaccharide CAPSULE condensed, well defined layer closely surrounding the cell contributes to invasiveness of pathogenic...
Ngày tải lên: 12/12/2013, 17:15
Tài liệu Mechanical Properties of Engineered Materials P2 pptx
... and 2.8(f) These may be thought of as the absence of a plane of atoms (intrinsic stacking faults) or the insertion of rows of atoms that disturb the arrangement of atoms (extrinsic stacking faults) ... example of volume defects is presented in Fig 2.9 This shows MnS inclusions in an A707 steel Another example of a volume defect is presented in Fig 1.16(d) This shows evidence of $1–2 vol % of porosity ... approximately 0.3–0.5 of the melting temperature in degrees Kelvin Since the evolution of microstructure is often controlled by diffusion processes, a brief introduction to elementary aspects of diffusion...
Ngày tải lên: 23/12/2013, 00:15
Tài liệu Mechanical Properties of Engineered Materials P1 pptx
... mechanical properties of materials It is not intended to be a comprehensive review of all the different aspects of mechanical properties; such a task would be beyond the capabilities of any single ... macroscopic level of understanding of structure [Figs 16(a)–(d)] They are often unaware of the atomic and microstructural constituents that can affect the mechanical behavior of materials and of the role ... Appreciation is also extended to Prof Tom Eager and Prof Nam Suh of MIT for inviting me to spend a sabbatical year as Visiting Martin Luther King Professor in the departments of Materials Science and Engineering...
Ngày tải lên: 23/12/2013, 00:15
Electronic and Optoelectronic Properties of Semiconductor Structures
... University of Michigan, Ann Arbor He has held visiting positions at the University of California, Santa Barbara and the University of Tokyo He is the author of over 250 technical papers and of seven ... that allow modifications of electronic properties; use of alloys, quantum wells, strain and polar charge are discussed; iii) electron (hole) transport and optical properties of semiconductors and ... Structure of the electronic device Structure of the optoelectronic device Desired OEIC Substrate APPROACH Growth of the optoelectronic device structure Substrate Mask a portion of the layer Regrowth of...
Ngày tải lên: 24/01/2014, 17:34
Tài liệu Psychometric properties of the quality of life scale Child Health and Illness Profile-Child Edition in a combined analysis of five atomoxetine trials pdf
... sub-domain (item 1: ‘‘How often does your child have a lot of fun?’’ and item 4: ‘‘How often does your child feel happy?’’) The items of the SPS sub-domain Psychometric properties of the CHIP-CE composed ... discussion of the impact of ADHD on QoL as measured by the CHIP-CE can be found elsewhere (Escobar et al 2005, 2010) Internal psychometric properties of the CHIP-CE Missing values The proportion of CHIP-CE ... sub-domains of the CHIP-CE versus ADHD-RS total score were low (\0.4) (e.g., CHIP-CE The objective of this combined analysis was to evaluate the psychometric properties of the CHIP-CE in a sample of children...
Ngày tải lên: 12/02/2014, 19:20
Tài liệu Báo cáo "Effect of the preparation conditions on the properties of Fe-Pt nanoparticles produced by sonoelectrodeposition " pptx
... the current was turned off for a fixed duration toff of 0.5 s During ton, FePt nanoparticles were deposited on the surface of the electrode When the current was switched off, an ultrasound was ... has the potential benefit of combining sonochemistry with electrochemistry Some of these beneficial effects include acceleration of mass transport, cleaning and degassing of the electrode surface, ... percent of Fe was higher because the standard electrode potential Fe2+/Fe (-0.44 V [17]) is more negative than that of Pt4+/Pt (0.742 V [18]) Table1.Chemical composition, magnetic properties of the...
Ngày tải lên: 13/02/2014, 03:20
Tài liệu Báo cáo " Signficantly improving magnetic properties of Sr-La-Co hexagonal ferrite" doc
... increase up-spin of positions 2a and 2b About the role of La to improve hard magnetic properties of hexagonal ferrite, the Vietnamese researchers have published a large number of publications ... Properties of La-Co substituted M-Type Sr-Ferrite ultrafine Powders prepared from citrate recursors, Proc of the ICF9, SanFrancisco, California, USA (2004) 75 [9] L Neél Magnetic Properties of ... and properties of Sr ferrite, J Phys IV, France (1997) CI 313 [17] N.Chau, N.K.Dung, D.L.Minh, B.T.Cong, High hard magnetic properties of Sr hexagonal ferrite substituted by La, Proceedings of...
Ngày tải lên: 13/02/2014, 03:20