physical realization of a quantum game

Báo cáo hóa học: "Research Article A Modified Run-Length Coding towards the Realization of a RRO-NRDPWT-Based ECG Data Compression System" pdf

Báo cáo hóa học: "Research Article A Modified Run-Length Coding towards the Realization of a RRO-NRDPWT-Based ECG Data Compression System" pdf

... propagation resistance and a uniform distribution of subband error The two mechanisms facilitate the significant normalization of subband data and a quantization scheme design with linear distortion ... 76.7(%) of total logic elements Note that with the limitation of EP2C35F672C6, we cannot evaluate 64-sample case or larger In this paper, towards the realization of RRO-NRDPWTbased ECG data compression ... determination of quantization scales, we define c j as cj = cp j , SNF j (3) − j+1 where SNF j = maxl { 2=2− j |akl |} is a significant normalk ization factor and cp[ j] are adjustable parameters and akl...

Ngày tải lên: 21/06/2014, 05:20

8 394 0
Báo cáo hóa học: " Design and Realization of a New Signal Security System for Multimedia Data Transmission" ppt

Báo cáo hóa học: " Design and Realization of a New Signal Security System for Multimedia Data Transmission" ppt

... technology as shown as follows: Besides, we also define an index of data rate per area (DRPA), that is, Data rate/NArea, as shown in (21), to reflect the efficiency of the hardware design for data encrypter ... eliminate the factor of different fabrication technologies, we define an index of normalized area (denoted by NArea), which is the silicon area normalized to a 0.35 µm NArea = DRPA = Area (Technology/0.35)2 ... This data-processing rate is fast enough for realtime data protection in multimedia data transmission applications The proposed signal security system is suitable for both software and hardware...

Ngày tải lên: 23/06/2014, 01:20

15 422 0
Design of a Video Game docx

Design of a Video Game docx

... communication address 000 001 010 100 101 111 name ADDR0 ADDR1 ADDR2 DATA0 DATA1 CMD A7 A1 5 A2 3 D7 D15 A6 A1 4 A2 2 D6 D14 A5 A1 3 A2 1 D5 D13 A4 A1 2 A2 0 D4 D12 A3 A1 1 A1 9 D3 D11 A2 A1 0 A1 8 D2 D10 A1 A9 ... 1011 1100 R DATA0 DATA1 STATUS - KEYBOARD W ADDR0 ADDR1 ADDR2 DATA0 DATA1 COMMAND OPAQUECOLOR ALPHA 1A ALPHA1B ALPHA 2A - Table - PicoBlaze I/O ports In addition to the I/O ports, an interrupt ... image format is very close to raw image data and it is relatively easy to create with any graphics editing software, the image data is read from the BMP format For that, the start address has to...

Ngày tải lên: 27/06/2014, 00:20

10 271 0
Electromagnetic analysis and design of semiconductor qubit structures for the realization of the quantum computer

Electromagnetic analysis and design of semiconductor qubit structures for the realization of the quantum computer

... adopted an analytical approach for obtaining the A- gate potential which means that it is only applicable to ideal structures of A gates (an ideal circular plate) Then perturbation theory was used ... by Larionov et al.37 However the Larionov study adopted an analytical approach for obtaining the A- gate potential which means that it is only applicable to ideal structures of A gates (an ideal ... These factors, as well as the ability of quantum spin control, have attracted a vast interest in silicon-based quantum devices during the past years Although there have been many realization methods...

Ngày tải lên: 30/09/2015, 06:37

135 291 0
Optimal fundamental characteristic of a quantum harmonic

Optimal fundamental characteristic of a quantum harmonic

... irreversibilities of heat resistance, internal friction and bypass heat leakage The working medium of the quantum refrigerator is consisting of many noninteracting harmonic oscillators The quantum refrigeration ... cooling load when there exists a bypass heat leakage The optimal performance of the quantum Carnot refrigerator at high temperature limit is derived and analyzed in detail with numerical examples, ... losses of heat resistance, internal friction and bypass heat leakage, Liu et al [36, 37] established models of general irreversible quantum Carnot heat engines with harmonic oscillators [36] and...

Ngày tải lên: 20/11/2015, 14:04

16 124 0
COSMOS A SKETCH OR A PHYSICAL DESCRIPTION OF THE UNIVERSE ppt

COSMOS A SKETCH OR A PHYSICAL DESCRIPTION OF THE UNIVERSE ppt

... vegetation, and classification of the genera of animals Isolated and social living plants and animals The character of flora and fauna is not determined so much by the predominance of separate families, ... to hope that an attempt to delineate nature in all its vivid animation and exalted grandeur, and to trace the 'stable' amid the vacillating, ever-recurring alternation of physical metamorphoses, ... Comparative hypsometrical data of the elevations of the Dhawalagiri, Jawahir, Chimborazo, Aetna (according to the measurement of Sir John Herschel), the Swiss Alps, etc p 28 Rarity p 16 of palms...

Ngày tải lên: 28/03/2014, 20:20

792 272 0
More Than a Numbers Game: A Brief Histor y of Accounting pdf

More Than a Numbers Game: A Brief Histor y of Accounting pdf

... shareholder votes Management abuses can easily arise from institutional separation of management from ownership: A notable example was RJR Nabisco’s extravagant 1980s spending on a corporate aircraft ... snappy phrases came to mind Hey, let’s book another entry The manager had learned that a client had amassed a sizable bond position and sustained adverse interest rate changes Financial statements ... often devoid of natural resources Rail networks absorbed armies of surveyors, graders, and tracklayers The Union Pacific supervised thousands of Civil War veterans using a paramilitary management model...

Ngày tải lên: 30/03/2014, 14:20

258 1,3K 1
Báo cáo khoa học: "The adaptation of a machine-learned sentence realization system to French" potx

Báo cáo khoa học: "The adaptation of a machine-learned sentence realization system to French" potx

... 329 Langkilde I and Knight K (199 8a) "The practical value of n-grams in generation" In Proceedings of the 9th International Workshop on Natural Language Generation, Niagara-on-the-Lake, Canada pp ... modal verbs In German and English syntactic analysis, modals not head a clause but behave like auxiliaries In French, however, modals behave syntactically just like main verbs (taking a clausal ... Amalgam French Amalgam re-uses the architecture of the German system Indeed, sentence realization from a semantic graph must undergo many of the same transformations regardless of the language:...

Ngày tải lên: 31/03/2014, 20:20

8 295 0
Báo cáo khoa học: "A Dynamic Logic Formalisation of the Dialogue Gameboard" potx

Báo cáo khoa học: "A Dynamic Logic Formalisation of the Dialogue Gameboard" potx

... vocabulary E, including T and I The set (I) of well-formed formulae A is then defined as follows: A ::= —'24_ A1 A A2 Al V A2 VxAl]xA [a] A 1 A —> A2 In the basic version of DL, atomic programs ... perspective, a dialogue can be thought of as a conversational scoreboard that keeps track of the state of the conversation The dialogue gameboard (DGB), Ginzburg's particular version of the conversational ... clr and ack, and an infinite set Var of variables x Var includes a set V1 = { LMa , LMb, UTTI of special individual variables and a set V2 = {FACTS, QUD a , QUDb, PENDING,, PEND ING} of stack variables...

Ngày tải lên: 31/03/2014, 20:20

8 674 0
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx

... that physical activity partially mediates the impact of chronic conditions on several health outcomes that are important to quality of life Physical activity of at least 1,000 Kcal per week was ... likelihood estimation (FIML) (available in the Mplus 4.2 [30] software package) by using all available data to assess whether the estimates may have been biased by non-random missing data patterns (n ... in older adults The data were collected by Statistics Canada under the authority of the Statistics Act Access to the data was granted by Statistics Canada based on a peer-reviewed proposal for...

Ngày tải lên: 18/06/2014, 22:20

11 619 0
báo cáo hóa học: "Ambulatory measurement of knee motion and physical activity: preliminary evaluation of a smart activity monitor" pdf

báo cáo hóa học: "Ambulatory measurement of knee motion and physical activity: preliminary evaluation of a smart activity monitor" pdf

... property Data Analysis Data were processed and analyzed after testing each subject The same time interval of BML and IDEEA data was analyzed for the three specific physical activities (gait, stepping, ... experiments, and assisted in analyzing the data and revising the manuscript All authors read and approved the final manuscript Acknowledgements The authors thank Patrick Duplessis for his assistance ... Journal of NeuroEngineering and Rehabilitation 2006, 3:21 Background The complexity of human physical activity has made it challenging to produce a validated, accurate, and costeffective...

Ngày tải lên: 19/06/2014, 10:20

10 378 0
A review of the chemical and physical mechanisms of the storage stability of fast pyrolysis bio oils

A review of the chemical and physical mechanisms of the storage stability of fast pyrolysis bio oils

... organic acids such as oxalic acid (pKa = 1.3) and tartaric acid (pKa = 3.0) also catalyze acetalization, but acetic acid (pKa = 4.7) does not catalyze this reaction (Adams and Adkins 1925) Oxalic and ... than if the aldehyde group was attached to a secondary carbon (iso-butanal) Using the reaction of ethanol with aldehydes containing four carbon atoms as an example, saturated aldehydes had a ... Noncatalytic salts for this reaction include carbonates and chlorides of sodium and potassium; calcium and sodium sulfates; and calcium and sodium acetates (Adams and Adkins 1925; Adkins and...

Ngày tải lên: 19/06/2014, 14:02

59 668 0
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx

Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx

... years of practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on ... strain on the bursa subacromialis and so in a typical case of "painful arc" the movement would cause less pain The most reliable test of internal and external rotation is carried out with the arms ... Functional diagnostic examination of the thoracic and lumbar spine and the lumbar-pelvic-iliac region If the anamnesis is indicative of problems or the results of the screening are abnormal, a functional...

Ngày tải lên: 20/06/2014, 00:20

10 575 0
Báo cáo hóa học: " Fano-Rashba effect in thermoelectricity of a double quantum dot molecular junction" pptx

Báo cáo hóa học: " Fano-Rashba effect in thermoelectricity of a double quantum dot molecular junction" pptx

... Spin-polarized current and spin accumulation in a three-terminal two quantum dots ring Appl Phys Lett 2008, 92:172104-172106 41 Uchida K, Takahashi S, Harii K, Ieda J, Koshibae W, Ando K, Maekawa S, ... Jiangsu Laboratory of Advanced Functional materials and College of Physics and Engineering, Changshu Institute of Technology, Changshu 215500, China 2Department of Theoretical Chemistry, School of ... state and an asymmetrical Fano line shape centered at the antibonding molecular state The degree of the asymmetry of the Fano-Like peak can be attributed to the electron phase coherence In the table...

Ngày tải lên: 20/06/2014, 23:20

10 351 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific PCR upper primer TGT GCT GCC ATA TCT ACT TCA GAA ACT AC Type-specific ... crystalline phase of superparamagnetic nanoparticles Table Hybridization probes and type-specific PCR primers Sequence Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT ... hybridization assay method only require extraction of DNA of the samples and simple incubation as well as magnetic separation, which has a good acceptability for any average lab assistant Table Comparison...

Ngày tải lên: 21/06/2014, 01:20

9 469 0
Báo cáo hóa học: " Improved conversion efficiency of Ag2S quantum dot-sensitized solar cells based on TiO2 nanotubes with a ZnO recombination barrier layer" pdf

Báo cáo hóa học: " Improved conversion efficiency of Ag2S quantum dot-sensitized solar cells based on TiO2 nanotubes with a ZnO recombination barrier layer" pdf

... HR-TEM as seen in Figure 3c The characteristics peaks in the spectrum are associated with Ag, Ti, O, Zn, and S The quantitative analysis reveals the atomic ratio of Ag and S is close to 2:1, indicating ... Energy diagram and dark current (a) Energy diagram of Ag2S-sensitized ZnO/TNT solar cells and (b) the dark current of the Ag2S(4)/ ZnO/TNT and Ag2S(4)/TNT electrodes Chen et al Nanoscale Research ... Tran Components and Packaging Technologies 2007, 30:666-672 23 Wang HL, Qi LM: Controlled synthesis of Ag2S, Ag2Se, and Ag nanofibers by using a general sacrificial template and their application...

Ngày tải lên: 21/06/2014, 01:20

9 398 0
Báo cáo hóa học: " Linear Rashba Model of a Hydrogenic Donor Impurity in GaAs/GaAlAs Quantum Wells" potx

Báo cáo hóa học: " Linear Rashba Model of a Hydrogenic Donor Impurity in GaAs/GaAlAs Quantum Wells" potx

... -W/2 W/2 W Fig The Rashba parameter as a function of z The horizontal and vertical dashed lines indicate the value of a0 and the borderline of the QW, respectively Fig The change in spin-orbit ... splitting energy of a hydrogenic donor impurity in a GaAs=Ga0:65 Al0:35 As QW We take the effective mass parameters of [13] and the Rashba parameter a0 ¼ 10À12 eV m [14] The spin-orbit splitting energy ... jzj W; W aR ðzÞ ¼ ð3Þ for jzj [ W; where a0 is the maximum value of the Rashba spin-orbit effect at the side of the QW The Rashba parameter is a function of z and is dependent on the size of the...

Ngày tải lên: 22/06/2014, 01:20

3 248 0
Báo cáo hóa học: " Strain Relief Analysis of InN Quantum Dots Grown on GaN ´ ´ Juan G. Lozano Æ Ana M. Sanchez Æ Rafael Garcıa Æ ´ Sandra Ruffenach Æ Olivier Briot Æ David Gonzalez" pot

Báo cáo hóa học: " Strain Relief Analysis of InN Quantum Dots Grown on GaN ´ ´ Juan G. Lozano Æ Ana M. Sanchez Æ Rafael Garcıa Æ ´ Sandra Ruffenach Æ Olivier Briot Æ David Gonzalez" pot

... planar view TEM showed that the QDs had a well-defined truncated hexagonal pyramidal shape [9], with an average diameter (d) of 73 ± 12 nm and an average height (h) of 12 ± nm, giving a typical ... a magnified area of the stress map of the boundary of the QD, calculated using elastic theory [18] from the corresponding strain maps and elastic constants [19] A regularly spaced set of red and ... MDs are marked with arrows (b) Combined image of a GPA-generated strain map and HTREM image showing the misfit dislocation network The indicated axes are b parallel to h1" i directions and a parallel...

Ngày tải lên: 22/06/2014, 18:20

5 240 0
Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt

Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt

... have measured the rise and decay dynamics of the ground and first excited state of InAs QDs capped with an InGaAs quantum well We have found that the higher energy states of the QDs don’t act as ... and the InGaAs quantum well lowest state This suggests that at high temperature the thermal escape becomes the main non-radiative process Figure shows a comparison among the time evolutions of ... intermediate stages in the carrier relaxation, while the carriers can cool down to any lower energy states following a relaxation through a continuum background The fast capture, mediated by a continuum...

Ngày tải lên: 22/06/2014, 18:20

3 290 0
w