phase commit a method used in transaction processing that ensures

dictionary of e-business [electronic resource] a definitive guide to technology and business terms

dictionary of e-business [electronic resource] a definitive guide to technology and business terms

... frequency band and was also used in South America, Far East, and in the Asia Pacific region including Australia and New Zealand In the Asia Pacific country of Japan, NTT’s MCS system was the first ... creating ActiveX controls that may also be created using the: • C++ programming language • Java programming language • Visual Basic programming language (See Active X Control, Java, and Visual ... symbol used as a prefix in the hexadecimal counting system * A wildcard that may be used as a substitute for an undefined series of characters in a search string .COM A domain category that generally...

Ngày tải lên: 29/05/2014, 15:31

379 3,5K 0
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf

... database These are used in conjunction with a predefined multimodal grammar template and any available corpus training data to build a multimodal understanding model and speech recognition language ... Systems In Proceedings of the 40th ACL pp 376-383 Michael Johnston and Srinivas Bangalore 2005 Finitestate Multimodal Integration and Understanding Journal of Natural Language Engineering 11.2 Cambridge ... differentiate between lack of results due to recognition or understanding problems versus lack of items in the database This has to be balanced against degradation in accuracy resulting from increasing...

Ngày tải lên: 20/02/2014, 12:20

8 586 0
Báo cáo khoa học: "A speech interface for open-domain question-answering" doc

Báo cáo khoa học: "A speech interface for open-domain question-answering" doc

... could also improve recall For example, Q245 What city in Australia has rain forests? it answered correctly, but the transcription What city in Australia has rainforests (without a space), got no answers ... story In Proc Content-Based Multimedia Information Access Conf., apr J Kupiec, D Kimber, and V Balasubramanian 1994 Speech-based retrieval using semantic co-occurrence filtering In Proc ARPA Human ... described a small evaluation of the system’s accuracy given raw (uncorrected) transcribed questions from two speakers, which indicates that speech can be used for automatic question-answering, but that...

Ngày tải lên: 08/03/2014, 04:22

4 276 0
Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot

... multilinear data-structures onto a single tier increases the likeliness of combinatorial explosion in processing when using the two-level a u t o m a t a as transducers, it turns out that in our already ... component applying morphological and phonological rules to arrive at the representation used as input for speech synthesis A distinguishing feature of the grammar used in the generator is the integration ... specifying "appropriate" intonation and phrasing 4.1 Different perspectives The diversity of factors that influences intonation is mirrored in the variety of research that deals with intonation:...

Ngày tải lên: 08/03/2014, 06:20

5 498 0
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

... levels and generates an interactive table of scores displaying the values for all the measures Table organiza- 142 Graphically-aided Error Analysis and Diagnosis Human analysis is crucial in the ... developers that need to manually analyze and compare specific aspects of their systems During the evaluation process, A SIYA generates a number of intermediate analysis containing partial work outs ... Nizar Habash, and Mona Diab 2007 Semi-Automatic Error Analysis for Large-Scale Statistical Machine Translation Systems In Proc of the MT Summit XI, Copenhagen, Denmark Maja Popovi´ and Hermann...

Ngày tải lên: 16/03/2014, 20:20

6 453 0
Lab 3.1.5 Configuring a Serial Interface

Lab 3.1.5 Configuring a Serial Interface

... the command show interface serial on GAD Refer to interface chart GAD#show interface serial This will show the details of interface serial b List at least three details discovered by issuing this ... combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface ... ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 5-5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 3.1.5 Copyright...

Ngày tải lên: 05/11/2013, 12:15

5 342 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx

... of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command ... the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show interface ... Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following...

Ngày tải lên: 11/12/2013, 13:15

5 536 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc

... though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface ... show interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line ... configurations for each router class What is provided are the identifiers for the possible combinations of interfaces in the device This interface chart does not include any other type of interface...

Ngày tải lên: 11/12/2013, 13:15

6 369 0
Tài liệu Troubleshooting a Serial Interface doc

Tài liệu Troubleshooting a Serial Interface doc

... though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface ... show interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line ... configurations for each router class What is provided are the identifiers for the possible combinations of interfaces in the device This interface chart does not include any other type of interface...

Ngày tải lên: 11/12/2013, 15:15

6 276 0
Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt

... of interface even though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command ... the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show interface ... Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following...

Ngày tải lên: 18/01/2014, 04:20

5 433 0
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf

... though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface ... show interface serial (refer to interface chart) on Paris Paris#show interface serial This will show the details of interface serial Answer the following questions: a Serial is _, line ... configurations for each router class What is provided are the identifiers for the possible combinations of interfaces in the device This interface chart does not include any other type of interface...

Ngày tải lên: 24/01/2014, 19:20

6 324 0
Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt

... trial and distractor responses at channel Cz on a single-trial basis, rather than averaged over all trials The signals acquired from each EEG channel are incorporated and classified to determine ... high-dimensional data, singularities of these matrices are problematic RDA applies regularization and shrinkage procedures to the class covariance matrix 40 Figure 4: Single-trial EEG data at channel ... principal components analysis) is learned using training data and is subsequently applied to the EEG data when the system is being used Fourth, the data vectors obtained for each channel and a given...

Ngày tải lên: 20/02/2014, 05:20

6 551 0
Báo cáo: THIẾT BỊ LƯU TRỮ USB (Universal Serial Bus ) potx

Báo cáo: THIẾT BỊ LƯU TRỮ USB (Universal Serial Bus ) potx

... cấu tạo giống 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~  Mạch ASIC ( Application Specific Integrated Circuit ): não ổ đ a Flash USB Nó gồm có xử lý trung tâm 50 MHz ARM7 RISC, quản lý toàn chuyện ghi ... NAND thông dụng rẻ 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~ Sau lớp ổ đ a, gồm có phần sau:  Một mạch in ( printed circuit board ) đựoc hàn chung với nhớ ổ đ a nhiều thành phần khác Các nhà sản xuất ... memory khác  Bộ dao động tinh thể ( Crystal Oscillation ) sản xuất tín hiệu dạng đồng hồ dành cho xử lý trung tâm ASIC Tất thành phần khác mạch in tự đồng tần số với phần dao động tinh thể  Đèn...

Ngày tải lên: 31/07/2014, 11:20

19 471 1
AN1157   a serial bootloader for PIC24F devices

AN1157 a serial bootloader for PIC24F devices

... nonvolatile memory: program Flash, data EEPROM and Configuration bits Additionally, there are commands for special operations, such as repeating the last command, replicating the data and resetting ... PACKET FORMAT The is used to identify a value that could be interpreted in the data field as a control character Within the data field, the bootloader will always accept the byte following ... Technology Inc Data EEPROM Operations Some PIC24F devices have built -in data Flash memory EEPROM The bootloader allows data Flash to be read and erased at a word level, bytes at a time Erases are done...

Ngày tải lên: 11/01/2016, 16:47

26 533 0
Serial Interface (SCI)

Serial Interface (SCI)

... http://resource.renesas.com Page 142 What are the characteristics of serial data input/output compared with that of parallel data? Enter an appropriate word in parentheses Answer It takes (longer) time for inputting/outputting ... use as a counter A CR (Carriage Return) code and a LF (Line Feed) code are transmitted to effect a line feed after each line of data has printed The CR and LF are represented by H'0D and H' 0A, ... CR and an LF are transmitted in succession, the cursor moves to the beginning of the next line Write a subroutine that prints A through Z Write a subroutine that receives one character at a time...

Ngày tải lên: 29/09/2013, 11:20

18 289 0
Serial Interface to PIC

Serial Interface to PIC

... of sharewares which is doing the same things The download URLs are given in the references [41, 42] In fact they have more capabilities than that included in MS Windows [43] The main advantage ... in many technical manuals on web and may be referred for in depth information [44–46] 4.3 Displaying Data on HyperTerminal RS232 (single-ended) communication with PC was introduced way back in ... inherent calibration facilitates easy interfacing to the outside world As shown in Fig 4.5 Receiving sensor data on the HyperTerminal 76 Serial Interface to PIC Fig 4.5 only a unity gain amplifer...

Ngày tải lên: 03/10/2013, 01:20

10 271 0
Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt

Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt

... were indexed in a way that retained their internal tree structure, while multilingual files can easily be handled during indexing and searching phases; S Whittaker and M Walker 1991 Toward a theory ... details on the hit, i.e information an advanced user would get, are available following the advanceinformation link The use of semantic relations in multimedia data, in this case, is hidden in ... using it as training data for semantic multimedia processing applications, and • it will allow interfacing with semantic lexical resources, computational lexicons, text processing components and cross-lingual...

Ngày tải lên: 22/02/2014, 02:20

4 294 0
Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx

Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx

... by pattern matching in units of morphemes and the meaning ascribed beforehand to that statement is obtained An example of such pattern is shown in Figure using the metacharacters listed in Table ... is that it can be directly touched and manipulated to create a feeling of warmth and closeness On hearing a greeting or being called by its name, the IFR opens its eyes and enters a state that ... Configuration of interface system formation obtained from the Internet or overlaid data in digital broadcasts; the scheduling of program recording; and the browsing of programrelated information...

Ngày tải lên: 31/03/2014, 03:20

4 271 0
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx

... ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA ... GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in X/preC ... commercially available kits (QIAamp DNA Blood Mini Kit, QIAGEN, Inc., Valencia, CA) Polymerase chain reaction Full length amplification The PCR was performed in a 96-well cycler (GeneAmp PCR...

Ngày tải lên: 18/06/2014, 18:20

7 404 0
w