performance is a key feature

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot

... Hodgkiss RJ, Raleigh JA & van der Kogel AJ (2000) Spatial relationship between hypoxia and the (perfused) vascular network in a human glioma xenograft: a quantitative multi-parameter analysis Int ... intermittent hypoxia ⁄ reoxygenation Biochem Biophys Res Commun 355, 728–733 Hayakawa M, Miyashita H, Sakamoto I, Kitagawa M, Tanaka H, Yasuda H, Karin M & Kikugawa K (2003) Evidence that reactive oxygen ... the vascular endothelial growth factor stress response increases the antitumor effects of ionizing radiation Cancer Res 59, 3374–3378 101 Kanaan A, Farahani R, Douglas RM, Lamanna JC & Haddad GG...

Ngày tải lên: 30/03/2014, 04:20

12 390 0
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt

... somata (S) of the brain Fluorescence images were converted to grayscale and inverted into black and white images An area adjacent to the area of interest (A) and an area from an image lacking a ... sequence and dimeric structure Agric Biol Chem 55, 73–86 Kawakami A, Kataoka H, Oka T, Mizoguchi A, Kimura-Kawakami M, Adachi T, Iwami M, Nagasawa H, Suzuki A & Ishizaki H (1990) Molecular cloning ... multicellular organisms [15] There are four isoforms (A D) of mammalian MEF2, and they have high homology within the 56-amino-acid MADS box at their N-termini and within an adjacent 29-amino-acid region...

Ngày tải lên: 30/03/2014, 20:20

10 437 0
Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot

Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot

... cytotoxicity assays and manuscript preparation EHG carried out statistical analysis and manuscript preparation TBG carried out patient referral, clinical data analysis and manuscript preparation MHP carried ... patient referral, data analysis and manuscript preparation All authors read and approved the final manuscript Acknowledgements This work was supported, in part, by NIH grant PO1 AR048929 (to AAG), ... be a distinguishing feature of sJRA that is intrinsic to the disease itself Further analysis of the flow cytometry data revealed that some of the patients with sJRA had a rather selective disappearance...

Ngày tải lên: 09/08/2014, 06:22

8 365 0
báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot

báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot

... (nigella sativia) belongs to the Ranunculaceae family which grows in the Mediterranean sea and Western Asia countries, including Pakistan, India and China [74] This plant is used in traditional folk ... Clark A, Pradhan S, Jacobsen SE: UHRF1 plays a role in maintaining DNA methylation in mammalian cells Science 2007, 317:1760-1764 Sharif J, Muto M, Takebayashi S, Suetake I, Iwamatsu A, Endo TA, ... Tajima H, Fujita H, Takamura H, Ninomiya I, Fujimura T, Ohta T, Yashiro M, Hirakawa K: Effects of valproic acid on the cell cycle and apoptosis through acetylation of histone and tubulin in a...

Ngày tải lên: 10/08/2014, 10:21

10 414 0
Báo cáo y học: "Shuffling of cis-regulatory elements is a pervasive feature of the vertebrate lineage" ppsx

Báo cáo y học: "Shuffling of cis-regulatory elements is a pervasive feature of the vertebrate lineage" ppsx

... T-AGCCGTGTGCTATGTGAAAGATGGCAG-GCTTAAAAAAT human TCAGCCATGTGCTATGTGAAAGATGGCAGGCTTAAAAAAAT rat T-AGCCATGTGCTGTCTGAAGGATGGCAG-GCTTAAAAAAT dog TCAGCCATGTGCTGTGTGAAAGATGGCAGGCT-TAAAAAAT fugu TTAGCCATGT ... TGGTTCAGCCAGACTCTCTGGCTCAGATACACTAAGGGGT TGGTTCAGCCAGACTCTCTGGCTCAGATACACTAACTGCT TGGTTCAGCCAGACTCTCTGACTCAGATACACTAAGGGGT TGGCTCAGCCAGACTCTCTGGCTCACATACACTAACTGGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT TGACACAGACAGACTGTCTGTCTCTGCTGCACTAAGGAGT ... TTAGCCATGT CATGATAAAGATAGCAC-CTATATTTGAT TTAGCTGTGT CATGATAAAGATAGCAC-CTATATTTGAT tetr danio TTAATCTGGTGCTTTGTGCAGTAAAACAG-TTCTACAGAAT refereed research fugu deposited research 5‘ SCE Rat Dog...

Ngày tải lên: 14/08/2014, 16:21

19 510 0
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf

... NCOA3-D NR 4A3 -A NR 4A3 -B NR 4A3 -C PCAF -A PCAF-C PDGFRA -A PDGFRA-B PDGFRA-C PKD1 -A PKD2 -A PKD2-B PKD2-C PKD2-D PPARA -A PPARA-B PPARA-C PPARA-D PPARA-E PPARA-F PPARA-H PTEN -A RB1 -A RB1-B RB1CC1 -A ... FOXO 1A- C FOXO 1A- D FOXO 1A- E FOXO 1A- F GAB1 -A HAS2 -A HDAC4 -A HDAC4-B HDAC4-C HDAC4-D HIF1 -A HIF 1A- B IRF1 -A KHDRBS1 -A KHDRBS1-B KPNA2 -A MAP3K8 -A MAP3K8-B MAPK9 -A MYCN -A MYCN-B NCOA3 -A NCOA3-B NCOA3-C ... Cordon-Cardo C, Lowe SW, Hannon GJ, Hammond SM: A microRNA polycistron as a potential human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe...

Ngày tải lên: 14/08/2014, 20:22

14 331 0
TAL - A National Database of Questions - Classification is the Key pptx

TAL - A National Database of Questions - Classification is the Key pptx

... matrices at all, so a classification: In this section example questions are displayed and then an approach to assigning a classification is discussed Maths/Algebra/ Linear Algebra/linear equations/ ... TAL - A National Database of Questions – Classification is the Key TAL - A National Database of Questions Classification is the Key FDTL awards the idea of shared assessment resources in this ... statements is true? Jon Sims Williams and Mike Barry TAL - A National Database of Questions – Classification is the Key tree structure containing all this is not ideal A more general approach...

Ngày tải lên: 30/03/2014, 13:20

9 318 0
Báo cáo y học: "Atherogenic lipid profile is a feature characteristic of patients with early rheumatoid arthritis: effect of early treatment – a prospective, controlled study" pps

Báo cáo y học: "Atherogenic lipid profile is a feature characteristic of patients with early rheumatoid arthritis: effect of early treatment – a prospective, controlled study" pps

... rheumatoid arthritis Arthritis Rheum 1995, 38:727-735 Tsimihodimos V, Karabina SA, Tambaki AP, Bairaktari E, Miltiadous G, Goudevenos JA, Cariolou MA, Chapman MJ, Tselepis AD, Elisaf M: Altered distribution ... Sundqvist KG, Lefvert AK, Rantapaa-Dahlqvist S: Activation of the immune system and inflammatory activity in relation to markers of atherothrombotic disease and atherosclerosis in rheumatoid arthritis ... Stanwix AE, Moomal Z: Rheumatoid arthritis and cardiovascular disease may share similar risk factors (Letter) Rheumatology 2001, 40:703-704 33 Dessein PH, Stanwix AE, Joffe BI: Cardiovascular...

Ngày tải lên: 09/08/2014, 08:22

7 495 0
Corporate social responsibility and firm performance in a developing nation is there any linkage

Corporate social responsibility and firm performance in a developing nation is there any linkage

... industry Panel Data Analysis For the econometric analysis of the data, I used a longitudinal panel data analysis In total I had 648 observations after taking care of the missing data 28 The companies ... media presence and engaging in social activities is likely to draw a good amount of attention from the media In addition, the country has a very vibrant capital market and reliable archival data ... used to measure this variable Since the social performance in a certain year is likely to have its impact on the subsequent year, a one year lag was used for this variable Control variables Firm...

Ngày tải lên: 04/10/2015, 08:00

38 346 0
 What is a Company Visual Identity?

What is a Company Visual Identity?

... Extended palette An extended palette is available for broader (screen) applications Compared with the basic palette, this colour palette comprises a number of heavier shades Each typeface is available ... thousands are separated by a comma; main and decimal sums by a decimal point For example: EUR 1,250.00 In Dutch, thousands are separated by a dot, main and decimals sums by a comma If there are ... with a similar function already exist, or can this new form be combined with an existing form? - Does the form have a name, and is this name as short as possible? - Is all the information requested...

Ngày tải lên: 23/10/2012, 13:53

14 880 0
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

... Minneapolis, USA) This assay measures biologically active VEGF121 and VEGF165 Statistical analysis Differences between patients and healthy controls were evaluated using a non-parametric Kruskal-Wallis test ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and ... coefficient and linear regression analysis was performed after logarithmic transformation of Ang-2 values (logAng-2) The primary outcome studied was 30-day survival and was calculated from the day of...

Ngày tải lên: 25/10/2012, 10:31

9 635 0
Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

... 36 and health-related quality of life after intensive care in Morocco Acta Anaesthesiol Scand 2007, 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral ... presented as the mean ± standard deviation for variables with a normal distribution, and as the median and interquartile range for variables with skewed distributions Parametric or nonparametric ... participated in the design of the study, and performed the statistical analysis RA conceived of the study, participated in the design of the study, performed the statistical analysis and Available...

Ngày tải lên: 25/10/2012, 10:35

10 598 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"

... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... cDNA (Salton, unpublished data) was isolated via Xba I-Apa I restriction cleavage, and cloned into the NheI-ApaI sites of a pShuttle vector to generate the expression cassette under regulation ... hypothesis was rejected at the 0.05 level in all analyses Statistical analysis Results Statistical analyses were performed using SigmaStat (version 3.0, SPSS Inc., Chicago, IL) Independently measured...

Ngày tải lên: 03/11/2012, 10:52

8 503 0
Life Is a Dream

Life Is a Dream

... philosophical significance LIFE IS A DREAM DRAMATIS PERSONAE Basilio King of Poland Segismund his Son Astolfo his Nephew Estrella his Niece Clotaldo a General in Basilio's Service Rosaura a Muscovite Lady ... ROS And now a lamp, a lamp! And now the hand That carries it FIFE Oh, Lord! that dreadful chain! ROS And now the bearer of the lamp; indeed As strange as any in Arabian tale, So giant-like, and ... national type of drama which Lope had established was maintained in its essential characteristics by Calderon, and he produced abundant specimens of all its varieties Of regular plays he has left a...

Ngày tải lên: 06/11/2012, 14:12

11 367 0
PERFORMANCE OF A COMBINED CONSTRUCTED WETLAND SYSTEM FOR TREATING VILLAGE SEWAGE IN LAKE DIANCHI VALLEY

PERFORMANCE OF A COMBINED CONSTRUCTED WETLAND SYSTEM FOR TREATING VILLAGE SEWAGE IN LAKE DIANCHI VALLEY

... the pollutants concentration was low in the rain season (from May to October) The data from the local weather station showed that the average annual rainfall and evaporation was 802mm and 2093mm, ... adopted to treat a typical village sewage There is the long rain season in local place always accompanied with strong storms at the beginning The stormwater runoff not only brings the large amounts ... constructed wetland, in which the 20-30cm depth of free water was kept above the bottom and the Phragmites communis was dominant macrophyte The area was 300m2 and hydraulic loading rate was 30cm/d...

Ngày tải lên: 05/09/2013, 08:40

8 450 0
DMF Decomposition and Nitrogen Removal Performance by a Mesh-Filtration Bioreactor under Acidic Conditions

DMF Decomposition and Nitrogen Removal Performance by a Mesh-Filtration Bioreactor under Acidic Conditions

... Association and Water Environmental Federation, (2005) Standard method for examination of water and wastewater, 21st ed [16] Japanese Standards Association (1998) Japanese Industrial Standards, JIS K0102 ... with a mesh- filtration unit instead of a membrane) was able to maintain biomass at a very high concentration In this process, stable filtration performance was obtained by intermittent filtration ... tetrazolium chloride for detection of metabolically active bacteria in activated sludge, Microbial Environ., 19, 61- 70 [15] American Public Health Association, American Water Works Association and...

Ngày tải lên: 05/09/2013, 09:38

8 434 0
w