peeling back the layers from the lives of a cell

... publication of easily accessible and free -of- charge abstracts of European standards with a clear indication of changes made whenever standards are revised. The Commission will, and the Member ... to finance and, at the same time, provide important leverage for the capital available for lending. As part of its overall proposal on the post-2013 Multiannual Financial Framework, the Commission ... market access strategies and participation in trade fairs (Cyprus, Czech Republic, Denmark, Estonia, France, Ireland, Italy, Latvia, Lithuania, Malta, the Netherlands, Poland, Portugal, the...

Ngày tải lên: 29/03/2014, 18:20

Ngày tải lên: 29/03/2014, 18:20

... four years which explains the fact that the available data dates back to 1996. A cross-country comparison of the innovation indicators can help identify national strengths, and areas of weaknesses ... which the relevant statistical data is available, to compare the performances of the European Union with those of the United States and Japan. The scoreboard is designed to capture the main drivers ... first introduced. It may take time for the benefits of change and innovation to be appreciated. The media are important as a source of information on progress in research and innovation: they also draw attention...

Ngày tải lên: 16/01/2014, 16:33

Ngày tải lên: 29/10/2014, 12:53

... North American studies all causes respiratory cardiovascular all causes respiratory cardiovascular all causes respiratory cardiovascular all causes respiratory cardiovascular Note: There were ... critical interface between the environment and the human body. An average person takes about 10 million breaths a year, and toxic substances in air can easily reach the lung and other organs ... peer-reviewed European studies was there- fore conducted to obtain summary estimates for certain air pollutants and health effects. The data for these analyses came from a database of time-series...

Ngày tải lên: 17/02/2014, 11:20

... regional and district level medical staff and their partners in the region of Kolda and Fatick. c. Capacity building aimed at mainstreaming ARH activities is continuing. A national training of ... Population Training and Research (CEFOREP) plan for the scale-up of adolescent health programs with funding from the AWARE Project in Burkina Faso and Mali. e. The Mauritanian Ministry of ... other Francophone African countries a. A national strategic plan for ARH was developed in Guinea with technical assistance from FRONTIERS. Guinean MOH staff at the highest level played a strong...

Ngày tải lên: 05/03/2014, 17:20

... protein sequence. Angle, the calculated angle between the helix axis and the plane of a model membrane. ASA, accessible surface area. +, the peptide has an adequate mean surface accessibility ‡ ... 87–111. 13 Iwanaga S, Okada M, Isawa H, Morita A, Yuda M & Chinzei Y (2003) Identification and characterization of novel salivary thrombin inhibitors from the ixodidae tick, Haemaphysalis longicornis. ... inhibitor of leu- kocyte elastase – and some of its putative physiological activities. In this regard, the proinflammatory effects of fragments generated from extracellular matrix deg- radation by elastase...

Ngày tải lên: 07/03/2014, 01:20

... Chordata (Pallu- sia nigra, Microcosmus gamus, Molgula occidentalis and Pyura vittata); 11 species of Cnidaria (Bartholo- mea annulata, Budonosoma granulifera, Cassiopea xamachana, Condylactys ... magnifica Phylum Annelida, Class Polychaeta, Subclass Palpata, Order Canalipalpata, Suborder Sabellida, Family Sabellidae, Genus Sabellastarte [14] The ‘tentacle crown’ and the ‘body’ parts of ... gigantea, Gorgonia ventalina, Lebrunia danae, Palythoa caribaeorum, Physalia phy- salis, Plexaura homomalla, Stichodactyla helianthus and Zoanthus pulchellus); two species of Annelida (Sabellas- tarte...

Ngày tải lên: 07/03/2014, 02:20

... cerevisiae MAP kinase cascades typically composed of three tiers of protein kinases, a MAP kinase (MAPK), a MAPK kinase (MAPKK) and a MAPKK kinase (MAPKKK), are common signalling modules in eukaryotic cells ... chosen n parameter perturbations. All these approaches are based on parameter perturbation experiments which are, however, not always achievable in many practical cases. In this paper, we therefore ... experimental data containing (partially) cor- rect dynamic pattern changes then we can infer the (partial) interaction structure of the underlying cellular network by integrating the analysis results...

Ngày tải lên: 07/03/2014, 21:20

... purification of the recombinant enzyme In order to c onstruct an expression vector for Cl -idh,two oligonucleotides (sense, 5Â -A AAAA CATATGGCAAGCA AATCGACCATCATCTACAC-3Â, and antisense, 5Â-AAA AA GGATCCCGGCTGAAAACCGGGCTGCATTA-3Â) were ... sequences were obtained with the program ALIGN contained within the CLUSTALW program provided by DNA Data Bank of Japan (DDBJ). The sequence data was analyzed using GENETYX software package (Software Development, ... 3.6-fold greater t han that of malate and 21-fold greater t han that of the sum of citrate and isocitrate. I n addition, 14 CO 2 -labeling indicated that oxaloacetate was one of the first stable products...

Ngày tải lên: 08/03/2014, 10:20

... racemic mixtures of certain amino acids with side chains containing polar groups. The side-chain selectivity of the acetyl-acceptor was probed, assaying L -aspartate and D -aspartate, L -a- amin- oadipic acid, L -leucine, ... OAT from B. stearothermophilus and T. neapolitana, radioactive studies have indicated that there is a covalent acetylation of the enzyme during catalysis [25]. By analogy with other N-terminal ... acetylglutamate synthase (ARGA), the acetyl group can be recycled, thus feeding the first step of the pathway. Some OATs are bifunctional, being capable of forming N-acetylglutamate from acetyl-CoA and...

Ngày tải lên: 08/03/2014, 22:20

... Forward: GCAAAGAAGGTCAATTGCTCC Reverse: TACGACAGCCAATGCCAGGAT ezpca Forward: GGAAAGGAACAGTGGGTTAGT Reverse: ATCAGCCGCCAAAGTGCCAGG ezpcb Forward: GGGAAGGAACGGTGGATTGAG Reverse: CTGCATTCAGAGGGCTAATGG ezpcc ... Forward: GGAACTCAACGGTGGATTAGT Reverse: CTCTACCACCAAGTGTTGGCT ezpcd Forward: TTCCTACCTTCAAAGCATGGG Reverse: GTGCTCAACTCAGGCATGTCA ezpce Forward: CTCATTCTCTCCAGAAGCTGG Reverse: GCTCCTAGACTCTGACACCAG Egg ... inferred from the egg envelope protein genes of the Japanese eel, Anguilla japonica Kaori Sano 1 , Mari Kawaguchi 2 , Masayuki Yoshikawa 3 , Ichiro Iuchi 4 and Shigeki Yasumasu 4 1 Graduate Program of...

Ngày tải lên: 15/03/2014, 23:20

... conditions [4,18,19]. The optimal pH for the purified cellulase from the larval gut of P. hilaris against CMC was also 5.5. This is reasonable for the physiological function of cellulase activity in larval guts as ... glucose, because there are few other potential mechanisms for eliminating it. ThemolecularmassofP. hilaris cellulase deduced from its DNA sequence is 36.0 kDa. The apparent molecular mass of the purified ... hilaris cellulase was, however, estimated to be 47 kDa from its mobility on SDS/PAGE. N-Terminal amino-acid sequencing analysis indicated that thematureproteinofP. hilaris cellulase was a truncated form,...

Ngày tải lên: 17/03/2014, 10:20

... To evaluate spatial and temporal associations, the data were analyzed as pairs of cases; spatial linkage was defined based in location within the same electoral ward. Temporal linkage was an overlap ... Alterations of Nutritional Status in Childhood Acute Leukemia 277 Alejandra Maldonado-Alcázar, Juan Carlos Núñez-Enríquez, Carlos Alberto Garc a- Ruiz, Arturo Fajardo-Gutierrez and Juan Manuel Mej a- Aranguré ContentsVI ... viruses asymptomatically, with only a few of them developing a re‐ lated-neoplasia. On the other hand, the retroviruses are also good candidates, as they already have been implicated in leukemias....

Ngày tải lên: 17/03/2014, 12:20

... nucleotide-binding activity of tissue transglutaminase and its regulation of transamidating activity. Proc. Natl Acad. Sci. USA 99, 2743–2747. 56. Nakamura, A. , Okagaki, T., Takagi, T., Nakashima, K., Yazawa, ... and 5Â-ATAGTCGACTTAAACGACAATAACTTG-3Â.Next, the resulting DNA fragment was inserted into BamHI and SalI of pET-24d vector (Novagen), which was modified by attaching a His 6 tag at the N-terminus of the ... that an acyl-transfer reaction identical to that of mammalian TGases is executed in the catalytic reaction of PpTGase. Compared with those of human TGase 2, an additional region exists at the amino...

Ngày tải lên: 17/03/2014, 23:20

... the health, education, and well-being of children and adolescents including the following: The American Academy of Pediatrics, The American Foundation for AIDS Research, The American Medical ... Medical Association, The American Psychological Association, The American Public Health Association, The Institute of Medicine, The Society for Adolescent Medicine, The National Education Association ... physical and emotional well-being across the lifespan. Although abstinence-only education programs claim to promote morality, it is a sad fact that these programs are ultimately immoral because they...

Ngày tải lên: 22/03/2014, 15:21

... of all the b Na-ScTxs from all the a Na-ScTxs. The a Na-ScTxs have identities of the order of 50% among themselves, the same being true for all the b Na-ScTxs (data not shown). However, when the ... toxins are capable of discriminating between Na + -channel isoforms of the same organism (e.g. the rat brain isoform rNa V 1.1 is 10-fold more sensitive to the action of the a Na-ScTx Lqq5 than the ... than the cardiac isoform rNa V 1.5 [67]). However, when the overall charge of both the toxins and the channels are considered together, a plausible explanation comes from analysis of the other region involved...

Ngày tải lên: 23/03/2014, 12:20

Ngày tải lên: 29/03/2014, 18:20

Ngày tải lên: 30/03/2014, 14:20

Ngày tải lên: 30/03/2014, 14:20