patient specific modeling of cardiovascular dynamics with a major role for adaptation

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Ngày tải lên : 18/02/2014, 16:20
... mm malate and 25 lm palmitoyl-l-carnitine as oxidative substrates State respiration (resting) was measured after addition of oxidative substrates, and state respiration after the addition of 300 ... 10)9 m ATP The concentration of mitochondrial ATP was expressed as micromoles of ATP per milligram of mitochondrial protein Statistical analysis Data are presented as the mean ± SEM Statistical differences ... mitochondrial fatty acid-transferring enzyme; MCAD, a representative fatty acid b-oxidation enzyme; PPARa, a key transcriptional regulator of fatty acid genes; UCP3; the cardiac-enriched GLUT4; and...
  • 7
  • 582
  • 0
báo cáo hóa học:" Right thoracic curvature in the normal spine" pdf

báo cáo hóa học:" Right thoracic curvature in the normal spine" pdf

Ngày tải lên : 20/06/2014, 04:20
... drafting the manuscript KH, HM, and YM performed part of literature review KM and KK performed part of acquisition of data YI participated in design and coordination and helped to draft the manuscript ... Journal of Orthopaedic Surgery and Research 2011 6:4 Authors’ contributions TD has contributed to conception and design of the study, acquisition of data, analysis and interpretation of data, and ... used patients without obvious chest and spinal diseases as determined by chest radiographs because the literature suggests that patients who have congenital heart disease are more likely to have...
  • 5
  • 353
  • 0
báo cáo hóa học:" Right thoracic curvature in the normal spine" docx

báo cáo hóa học:" Right thoracic curvature in the normal spine" docx

Ngày tải lên : 20/06/2014, 07:20
... drafting the manuscript KH, HM, and YM performed part of literature review KM and KK performed part of acquisition of data YI participated in design and coordination and helped to draft the manuscript ... Journal of Orthopaedic Surgery and Research 2011 6:4 Authors’ contributions TD has contributed to conception and design of the study, acquisition of data, analysis and interpretation of data, and ... used patients without obvious chest and spinal diseases as determined by chest radiographs because the literature suggests that patients who have congenital heart disease are more likely to have...
  • 5
  • 261
  • 0
Báo cáo hóa học: " Research Article Modeling On-Body DTN Packet Routing Delay in the Presence of Postural Disconnections" ppt

Báo cáo hóa học: " Research Article Modeling On-Body DTN Packet Routing Delay in the Presence of Postural Disconnections" ppt

Ngày tải lên : 21/06/2014, 11:20
... Mica2Dot nodes run from a 570 mAH button cell with a total sensor weight of approximately 10 grams The default CSMA MAC protocol is used with a data rate of 19.2 kbps Via software adjustments of ... simulation results can be compared with the experimental data for the exact same topology traces Those traces are also used to create the forwarding matrix in (7) for computing the analytical packet ... Therefore, for large networks, maintaining utility information for every node can create significant scalability concerns However, for small WBANs this is less of an issue because of their small...
  • 19
  • 351
  • 0
Báo cáo hóa học: " On the Compensation of Delay in the Discrete Frequency Domain" pot

Báo cáo hóa học: " On the Compensation of Delay in the Discrete Frequency Domain" pot

Ngày tải lên : 23/06/2014, 01:20
... with a delay which varies linearly over a 100-sample range In this case, we examine both theoretical and experimental performances In order to assure a causal experimental channel with a delay ... that of an FIR filter For equalisation of a linear delay channel, a filterbank FDAF can require in excess of an order of magnitude more bins than the number of taps required by a FIR filter The ability ... 4.1.2 Channel with linear delay Now consider an allpass channel, c (n), with a delay that varies linearly from to max samples over the sampling bandwidth Let the delay associated with channel ck...
  • 11
  • 309
  • 0
Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx

Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx

Ngày tải lên : 13/08/2014, 03:21
... inspiratory phase) of 14 cmH2O and a PEEP of cmH2O A carotid arterial catheter was placed for blood gas analysis (model ABL5; Radiometer Inc., Copenhagen, Denmark) and inline measurement of systemic arterial ... The large range was due to alveolar collapse (atelectasis) in the HP/LP group Measurements of alveolar area were made by manually tracing the outer wall of individual alveoli at both I and E ... analysis software Alveolar stability was assessed by the percentage change in the area of individual alveoli from I to E (%I – EΔ) Randomization of alveoli for measurement of alveolar stability...
  • 9
  • 277
  • 0
Báo cáo y học: "Morphological characterisation of portal myofibroblasts and hepatic stellate cells in the normal dog liver" pptx

Báo cáo y học: "Morphological characterisation of portal myofibroblasts and hepatic stellate cells in the normal dog liver" pptx

Ngày tải lên : 13/08/2014, 13:20
... (rat), desmin (rat) and actin (man and rat), but alpha-smooth muscle actin (α-SMA) is classically considered as an indicator of activation (man and rat) [6,9,11] However, in man α-SMA HSC reactivity ... variability regarding time of postmortal sampling and fixation, the age of the paraffin blocks, and age, sex and breed variation of the animals However, the used material reflects similar variability ... on formalin-fixed, paraffin-embedded tissues; experience with 63 markers J Vet Diagn Invest 2000, 12:307-311 Sako T, Shimoyama Y, Akihara Y, Ohmachi T, Yamashita K, Kadosawa T, Nakade T, Uchida...
  • 9
  • 284
  • 0
Báo cáo y học: " Cardiac effects of induction agents in the septic rat heart" potx

Báo cáo y học: " Cardiac effects of induction agents in the septic rat heart" potx

Ngày tải lên : 13/08/2014, 19:20
... text, tables and figures are displayed as means ± standard error of the mean Raw data from each functional and metabolic variable were compared by analysis of variance with repeated measures ... human disease by activating proand anti-inflammatory pathways Another limitation of this study is that in addition to cardiac depression, induction agents also induce a systemic vascular dilatation ... decrease in systolic arterial blood pressure in animal models and patients with advanced age and heart disease [21] In contrast, s(+)ketamine showed cardiac functionality over a wide range of concentrations...
  • 8
  • 286
  • 0
Tài liệu IN THE HEART OF AFRICA pptx

Tài liệu IN THE HEART OF AFRICA pptx

Ngày tải lên : 15/02/2014, 09:20
... Thompson Accordingly, of my few attendants, my dragoman was Mahomet, and my principal guide was Achmet, and subsequently I had a number of Alis Mahomet was a regular Cairo dragoman, a native of Dongola, ... advice—Hoping for the best—Ho for Central Africa! CHAPTER XV CHAPTER XV A start made at last A forced march—Lightening the ship—Waiting for the caravan—Success hangs in the balance—The greatest rascal in ... (cow of the desert) After sixteen hours' actual marching from Cassala we arrived at the valley of the Atbara There was an extraordinary change in the appearance of the river between Gozerajup and...
  • 219
  • 335
  • 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Ngày tải lên : 23/03/2014, 04:20
... 5Â-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â The complementary sequences were used as ... the American Brain Tumor Association Michael Reiss Fellowship (A. L.), Art of the Brain (A. L.), unrestricted funds from the Cancer Center of Santa Barbara (A. L.), and National Institutes of Health ... lateral surface of the cell membrane and spanned either the entire area of cell cell contact (Fig 7A) or a smaller area closer to the basal (Fig 7B) or apical (Fig 7C) membrane Plaques were also...
  • 14
  • 433
  • 0
The French in the Heart of America doc

The French in the Heart of America doc

Ngày tải lên : 31/03/2014, 13:20
... Indies, and make a path for the priests to the countless savages "in bondage of Satan." Parkman speaks of him as the "Aeneas of a destined people," and he is generally called the "father of Canada." ... might have come every league of the way from Havre or even from a quay of the Seine, by water, except for a few paces of portage at La Chine and at Niagara But that narrow strip of prairie which ... hundreds and thousands of fragments the anabasis that has had no katabasis the literal going up of a people, as we shall see, from primitive husbandry and handicraft and a neighborly individualism,...
  • 160
  • 497
  • 0
báo cáo hóa học: " Measuring health-related quality of life in Hungarian children with heart disease: psychometric properties of the Hungarian version of the Pediatric Quality of Life Inventory™ 4.0 Generic Core Scales and the Cardiac Module" pptx

báo cáo hóa học: " Measuring health-related quality of life in Hungarian children with heart disease: psychometric properties of the Hungarian version of the Pediatric Quality of Life Inventory™ 4.0 Generic Core Scales and the Cardiac Module" pptx

Ngày tải lên : 18/06/2014, 19:20
... Principles of Good Practice for the Translation and Cultural Adaptation Process for Patient- Reported Outcomes (PRO) Measures: Report of ISPOR Task Force for Translation and Cultural Adaptation Value ... instrument with numerous disease specific modules, already utilized in many translated versions, and with forms available for a wide range of ages (2-18 years) [30-35] The validity and reliability of ... Cardioverter-Defibrillators American Journal of Cardiology 2004, 93:582-587 52 Ternstedt BM, Wall K: Quality of life 20 and 30 years after surgery in patients operated for tetralogy of Fallot and for atrial septal...
  • 12
  • 619
  • 2
Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc

Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc

Ngày tải lên : 18/06/2014, 22:20
... (Taiwan) Dog Hamam (Japan) (15) Dog Hamam (Japan) Dog KDK1 (Japan) (16) Dog KDK1 Dog Ueno (Japan) (17) Dog Ueno (Japan) Dog Yanaka (Japan) (18) Dog Yanaka (Japan) Giant panda (China) (19) Giant ... USA) (9) Raccoon (Michigan, USA) A7 5/17 (10) A7 5/17 Dog (Colorado, USA) (11) Dog (Colorado, USA) Javelina (12) Javelina Raccoon dog T dog Tanu (13) Raccoon anu (Japan) (Japan) Dog (T aiwan) (14) ... 49) than for years 1998 and 2000, as was the percentage positive for CDV: 26/49 (45%) Precise data about the number of animals living within the forest preserve was not available It was also not...
  • 14
  • 346
  • 0
báo cáo hóa học:" Structural ambiguity of the Chinese version of the hospital anxiety and depression scale in patients with coronary heart disease" doc

báo cáo hóa học:" Structural ambiguity of the Chinese version of the hospital anxiety and depression scale in patients with coronary heart disease" doc

Ngày tải lên : 20/06/2014, 15:20
... Depression Scale Acta Psychiatr Scand 1991, 83:81-85 Malasi TH, Mirza IA, el Islam MF: Validation of the Hospital Anxiety and Depression Scale in Arab patients Acta Psychiatr Scand 1991, 84:323-326 ... using CFA [16] In studies of the HADS in patients with CHD using CFA, Page of (page number not for citation purposes) Health and Quality of Life Outcomes 2006, 4:6 a clear advantage of three-factor ... No factor analysis PCA CFA PCA PCA CFA FLI1** Zigmond and Snaith (1983) Moorey et al (1991) Dunbar et al (2000) Friedman et al (2001)* Razavi et al (1990) Caci et al (2003)** Number of factors...
  • 5
  • 392
  • 0
báo cáo hóa học:" Comparison of the SF-6D and the EQ-5D in patients with coronary heart disease" pdf

báo cáo hóa học:" Comparison of the SF-6D and the EQ-5D in patients with coronary heart disease" pdf

Ngày tải lên : 20/06/2014, 15:20
... health Both algorithms include an interaction term to account for an additional disutility in case one of the domains is scored at its most severe level Statistical analysis A qualitative assessment ... in that domain, rounding imputed values to the nearest integer, and then recalculating the SF-6D We performed parametric and non-parametric testing of baseline (Kruskal Wallis ANOVA) and change ... mental health; VT: vitality Figure Bland-Altman plot of EQ-5D and SF-6D Bland-Altman plot of EQ-5D and SF-6D Page of (page number not for citation purposes) Health and Quality of Life Outcomes 2006,...
  • 9
  • 408
  • 0
báo cáo hóa học:" Mapping of the EQ-5D index from clinical outcome measures and demographic variables in patients with coronary heart disease" pptx

báo cáo hóa học:" Mapping of the EQ-5D index from clinical outcome measures and demographic variables in patients with coronary heart disease" pptx

Ngày tải lên : 20/06/2014, 16:20
... treadmill time, CCS = Canadian Cardiovascular Society Angina Classification, SAQ = Seattle Angina Questionnaire, ECS = exertional capacity scale, ASS = anginal stability scale, AFS = anginal ... continuous variables in estimation and validation datasets Variable Estimation dataset sample size Validation dataset sample size Estimation dataset mean (SD) Validation dataset mean (SD) EQ-5D ... [14] The dataset was then divided in two by taking a random sample of 60% of the data and separating that data from the remaining 40% to provide an estimation dataset and a validation dataset, respectively...
  • 13
  • 334
  • 0
Báo cáo toán học: " A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law" pptx

Báo cáo toán học: " A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law" pptx

Ngày tải lên : 20/06/2014, 21:20
... the domain of attraction of the normal law, if there exist constants an > 0, bn ∈ R such that S n − bn d −→ N, an where N is the standard normal random variable We say that {Xn }n∈N satisfies ... 1.1 of [12] Remark 1.4 If EX < ∞, then X is in the domain of attraction of the normal law Therefore, the class of random variables in Theorems 1.1 is of very broad range Remark 1.5 Essentially, ... Ibragimov and Lifshits [5], Miao [6], Berkes and Cs´ ki [7], H¨ rmann [8], Wu [9, 10], and Ye and Wu [11] Huang and Zhang [12] and Zhang a o and Yang [13] obtained ASCLT results for self-normalized...
  • 13
  • 480
  • 0
Báo cáo hóa học: " Some nonlinear delay integral inequalities on time scales arising in the theory of dynamics equations" ppt

Báo cáo hóa học: " Some nonlinear delay integral inequalities on time scales arising in the theory of dynamics equations" ppt

Ngày tải lên : 21/06/2014, 01:20
... Feng et al Journal of Inequalities and Applications 2011, 2011:29 http://www.journalofinequalitiesandapplications.com/content/2011/1/29 Page 13 of 14 where K > ia an arbitrary constant, and ⎧ v ... nondecreasing, subadditive, and submultiplicative, that is, for a ≥ 0, b ≥ we always have ω (a + b) ≤ ω (a) + ω (b) and ω(ab) ≤ ω (a) ω(b) τ, a, j are the same as in Theorem 2.1 If u(t) satisfies ... Feng et al Journal of Inequalities and Applications 2011, 2011:29 http://www.journalofinequalitiesandapplications.com/content/2011/1/29 Page of 14 A time scale is an arbitrary nonempty closed...
  • 14
  • 418
  • 0

Xem thêm