pathogens and recombinant dna

Recombinant DNA I - Basics of molecular cloning Polymerase chain reaction cDNA clones and screening

Recombinant DNA I - Basics of molecular cloning Polymerase chain reaction cDNA clones and screening

... DNA pieces are joined in vitro to form recombinant molecules • Generate sticky ends on the DNA, e.g with restriction endonucleases • Tie DNA molecules from different sources together with DNA ... phage and P1 phage can carry large fragments of DNA – 20 kb for lambda – 70 to 300 kb for P1 • M13 phage vectors can be used to generate single-stranded DNA YAC vectors for cloning large DNA inserts ... anneal primers, and synthesize new DNA: duplex molecules of desired product PCR, cycle 5: exponential increase in product Cycle 5: Denature, anneal primers, and synthesize new DNA: 14 duplex molecules...

Ngày tải lên: 13/03/2014, 18:39

23 460 0
Báo cáo y học: "Effects of recombinant human growth hormone on HIV-1-specific T-cell responses, thymic output and proviral DNA in patients on HAART: 48-week follow-up" ppt

Báo cáo y học: "Effects of recombinant human growth hormone on HIV-1-specific T-cell responses, thymic output and proviral DNA in patients on HAART: 48-week follow-up" ppt

... Based Therapies and Vaccines 2008, 6:7 Table 1: Proviral DNA at baseline (week 0) and weeks 12, 24 and 48 after rhGH immunotherapy Proviral DNA, HIV-1 copy number/μg of total DNA Patienta Baseline ... management of the study and GM undertook patient care and management NI, AH, SW and JD carried out laboratory work, collected and analysed the data and conducted the transfer and interpretation of ... responses and the change in levels of proviral DNA between weeks and 12 This suggests that targeting HIV1 Nef with a proliferative T-cell response decreases the amount of proviral DNA/ μg total DNA, ...

Ngày tải lên: 11/08/2014, 10:23

13 359 0
Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

Tài liệu Báo cáo khoa học: The stereochemistry of benzo[a]pyrene-2¢-deoxyguanosine adducts affects DNA methylation by SssI and HhaI DNA methyltransferases pptx

... conformations on DNA methylation In this work, the effect of the intercalated [9] (+)-cis-antiB[a]P-N2-dG adduct on the DNA binding and catalytic activity of SssI and HhaI was examined and compared ... residues in the DNA duplexes, and are consistent with a base-flipping model of the dC target residue Binding and methylation studies The interactions of M.HhaI and M.SssI with DNA containing site-specifically ... intercalated into the DNA A Fig Bar graphs representing relative Kd (K rel ) and kcat (k rel ) values for binding and d cat methylation of DNA containing (+)-cis-B[a]PN2-dG and (+)-trans-B[a]P-N2-dG...

Ngày tải lên: 19/02/2014, 00:20

14 558 0
Tài liệu Poultry meat pathogens and its Control pptx

Tài liệu Poultry meat pathogens and its Control pptx

... which are widely used in both human and veterinary medicine Although salmonella and campylobacter spp are the predominat foodborne pathogens associated with poultry and are frequently implicated in ... for almost all major foodborne outbreaks in Europe and the USA In England and Wales ,the first case involving this organism occurred in 1982 and reported cases have increased steadily since then ... on Campylobacter and 16 on Listeria, including completed and on-going studies in both developed and developing countries, as well as those undertaken by FAO/WHO on Salmonealla and Campylobacter...

Ngày tải lên: 21/02/2014, 01:20

9 457 0
Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

Tài liệu Báo cáo khoa học: Different mechanisms for cellular internalization of the HIV-1 Tat-derived cell penetrating peptide and recombinant proteins fused to Tat docx

... and washed again with NaCl/Pi before being processed in VectashieldTM mounting solution (Vector Laboratories Inc., Burlingame, CA, USA) Internalization and detection of recombinant proteins Recombinant ... surface of the Tat-containing recombinant proteins and call other reasons to explain the differences in the mechanism of internalization between the CPP peptide and the Tat-containing proteins ... was supported by grants from the Association pour la Recherche sur le Cancer to B L and E V and from MURST and Istituto Superiore di Sanita¢, Rome, Italy to M G REFERENCES Allinquant, B., Hantraye,...

Ngày tải lên: 21/02/2014, 03:20

8 485 0
Tài liệu Báo cáo Y học: Temperature dependence of thermodynamic properties for DNA/DNA and RNA/DNA duplex formation pdf

Tài liệu Báo cáo Y học: Temperature dependence of thermodynamic properties for DNA/DNA and RNA/DNA duplex formation pdf

... Therefore, systemic and extensive investigations are still required to assign universally appropriate parameter sets of the temperature-dependent thermodynamics for the DNA/ DNA and RNA /DNA oligonucleotide ... the present study, we determined the temperatureindependent and temperature-dependent thermodynamic parameters of 24 DNA/ DNA and 41 RNA /DNA oligonucleotide duplexes The heat capacity changes were ... AND METHODS Material preparations DNA and RNA oligonucleotides were synthesized on a solid support using the standard phosphoramidite method with an Applied Biosystems Model 391 synthesizer and...

Ngày tải lên: 22/02/2014, 07:20

10 448 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

... )74G and )76G (bottom strand) and )33G, )35G, )46G, )56G and )68G (top strand) (Fig 3B) All the protected guanine bases except )56G are located in and around O1 and O2 Interestingly, )35G, )41G and ... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig 2A) was synthesized ... performed a DNase I footprinting experiment using 200 nm CI and radioactively labeled O DNA (Fig 2B) The footprints of both the top and bottom strands of O DNA reveal that two regions in O DNA became...

Ngày tải lên: 07/03/2014, 00:20

11 432 0
Báo cáo khoa học: In vitro expansion of DNA triplet repeats with bulge binders and different DNA polymerases pdf

Báo cáo khoa học: In vitro expansion of DNA triplet repeats with bulge binders and different DNA polymerases pdf

... [32P]ATP[cP] and polynucleotide kinase DNA polymerase assays A standard reaction (15 lL) contained lm each of the primer and template and mm each of deoxynucleoside triphosphate, DNA polymerase and the ... of DNA repeat sequences DDI-1A and DDI-1B on AAT, CAG and CA repeats are relatively better than for ATT, CTG and GT the labeled primer and the template expansion system implied that template and ... right-handed, hence in the P conformation [14] In order to observe the conformational transitions of DNA directly and to eliminate drug interference, the CD spectra of native DNA and altered DNA, ...

Ngày tải lên: 07/03/2014, 06:20

12 473 0
Báo cáo Y học: Tyrosine sulfation and N-glycosylation of human heparin cofactor II from plasma and recombinant Chinese hamster ovary cells and their effects on heparin binding pot

Báo cáo Y học: Tyrosine sulfation and N-glycosylation of human heparin cofactor II from plasma and recombinant Chinese hamster ovary cells and their effects on heparin binding pot

... serum-derived and recombinant HCII Natural and recombinant HCII were characterized further by peptide mapping After reduction and carboxamidomethylation, the proteins were digested with trypsin and the ... 2.5, and 100 lM, respectively) The amount of recombinant HCII secreted from MTXselected cell clones was determined by a sandwich ELISA employing a monoclonal mouse anti-HCII capturing Ig and a ... carboxamidomethylation and tryptic digestion of HCII from plasma and from recombinant CHO cells One to two nanomoles of the purified protein were reduced, carboxamidomethylated and digested with trypsin;...

Ngày tải lên: 08/03/2014, 22:20

12 489 0
Chapter 8: Recombinant DNA Technology

Chapter 8: Recombinant DNA Technology

... steps used to clone DNA?     Isolate DNA from an organism Cut the organismal DNA and the vector with restriction enzymes making recombinant DNA Introduce the recombinant DNA into a host Restriction ... of constructing a cDNA library? How is mRNA isolated for constructing a cDNA library and what special enzymes are required to prepare cDNA? What is adapter and linker DNA, and what advantages ... RNase H, DNA polymerase I, and DNA ligase Cloning of cDNA using BamHI linkers Screening     What screening method can be used to identify a recombinant clone with a target gene in a cDNA library...

Ngày tải lên: 13/03/2014, 19:33

44 1,9K 1
Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt

Báo cáo khoa học: Initiation of JC virus DNA replication in vitro by human and mouse DNA polymerase a-primase ppt

... poly (dT) Lanes and 2, control reaction with DNA polymerase a-primase lacking TAg or vice versa; lanes and 4, 0.2 U and 0.4 U of human; lanes and 6, 0.2 U and 0.4 U of murine DNA polymerase a-primase ... support DNA replication of a plasmid carrying the JCV origin Columns and 3, SV40 Tag with human and murine DNA polymerase a-primase, respectively; columns and 5, JCV Tag with human and murine DNA ... with BSA as a standard (Biorad, Munich) DNA polymerase a and DNA primase assays were performed as previously described [34,42,43] Preparation of S100 extracts and replication of SV40 and JCV in vitro...

Ngày tải lên: 17/03/2014, 03:20

8 326 0
Báo cáo khóa học: Comparison of native and recombinant chlorite dismutase from Ideonella dechloratans pot

Báo cáo khóa học: Comparison of native and recombinant chlorite dismutase from Ideonella dechloratans pot

... host, but not in the recombinant version of the enzyme Comparison of mass spectra for tryptic peptides obtained from the native and recombinant enzymes suggest HK(52– 53) and YHVR(220–223) as ... residue in the 52–55 region and a residue in the 215–223 region A tyrosine–histidine cross-link appears possible, and could account for EPR differences between the native and recombinant enzymes as ... concentrations of species giving rise to high- and low-spin signals were estimated as described in [27] and [28], respectively Results Electrophoresis of proteins and tryptic peptides We have previously...

Ngày tải lên: 23/03/2014, 12:20

8 289 0
Báo cáo khoa học: Characterization of native and recombinant A4 glyceraldehyde 3-phosphate dehydrogenase Kinetic evidence for conformation changes upon association with the small protein CP12 pptx

Báo cáo khoa học: Characterization of native and recombinant A4 glyceraldehyde 3-phosphate dehydrogenase Kinetic evidence for conformation changes upon association with the small protein CP12 pptx

... (Millipore) and ể FEBS 2003 Kinetics of native and recombinant GAPDHs (Eur J Biochem 270) 131 eluted in 50% acetonitrile/0.1% triuoroacetic acid and 50% water/0.1% triuoroacetic acid Recombinant and ... for recombinant and native GAPDH with a multit using a common value of Km and different values of kcat The estimated parameters had a value of 25 lM for the Km, and the kcat for recombinant and ... 0.85 mM Recombinant (j) and native (h) GAPDH (1.5 ã 10)9 M and ã 10)9 M, respectively) were placed in the assay cuvette and the appearance of product was monitored Mean rate constants and standard...

Ngày tải lên: 23/03/2014, 20:22

8 335 0
Molecular Biotechnology-Lession 2: Recombinant DNA technology docx

Molecular Biotechnology-Lession 2: Recombinant DNA technology docx

... production and intracellular replication of recombinant DNA appeared in 1972 and 1973 Stanford University applied for a US patent on recombinant DNA in 1974, listing the inventors as Stanley N Cohen and ... using recombinant DNA technology was human insulin, developed by Genentech and Licensed by Eli Lilly and Company  Applications of recombinant biotechnology  Recombinant human insulin  Recombinant ... and selectable marker are common to vectors  Self-replicating  Double stranded  Circular DNA  Independent extrachromosomal DNA in  Ampicillin bacteria 1kb-500kb  Kanamycin  Origin of DNA...

Ngày tải lên: 23/03/2014, 22:20

54 410 0
Water Microbiology. Bacterial Pathogens and Water ppt

Water Microbiology. Bacterial Pathogens and Water ppt

... procedure Gauthier et al [110] and Gauthier and Archibald [58] reported two studies of seven pulp and paper mills in Ontario and Quebec, Canada Total and fecal coliforms and enterococci were detected ... estuarine animals such as birds, frogs, fishes and shellfish, and survive and multiply on the surface of phytoplankton and zooplankton cells [8,21] V cholerae O1 and O139 strains are isolable from the ... and Citrobacter (C amalonaticus, C koseri and C freundii) These bacteria live in the animal and human gut, but also in the environment, and are easily isolated from the soil, polluted water and...

Ngày tải lên: 29/03/2014, 14:20

47 469 0
Báo cáo khoa học: Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana ppt

Báo cáo khoa học: Detection of nucleolar organizer and mitochondrial DNA insertion regions based on the isochore map of Arabidopsis thaliana ppt

... preference and amino acid usage are calculated for genes in each isochore and chromosome Table lists the results for the NOR and the mitochondrial DNA insertion isochore in chromosome II and the ... NORs juxtapose the telomeres of chromosomes II and IV, which comprise uninterrupted 18 s, 5.8 s, 25 s RNA and s RNA genes, and they form the structural and catalytic cores of cytoplasmic ribosomes ... composed of several GC-rich and AT-rich regions alternatively The identified isochores, centromeric regions and NOR in chromosome II and IV are indicated with black lines, red and orange dots, respectively...

Ngày tải lên: 30/03/2014, 20:20

9 523 0
recombinant dna part a

recombinant dna part a

... vehicle DNA, and a complementary extension to each 3'-end of the passenger DNA (see this volume [3]) An attractive application is to add dG tails to PstI-cleaved pBR322 DNA and dC tails to the DNA ... Inoue, D Pereira, J C Hsu, L Alexander, and L Rock, in "Molecular Cloning of Recombinant DNA" (W A Scott and R Werner, eds.), p 99 Academic Press, New York, 1977 [1] RECOMBINANT D N A TECHNIQUES ... cloning of yeast DNA, or certain prokaryotic DNAs, in yeast A vehicle for recombinant DNA and a transformation procedure are also available for Staphylococcus aureus.S2 Many recombinants containing...

Ngày tải lên: 11/04/2014, 10:25

543 411 0
recombinant dna part b

recombinant dna part b

... lambda DNA under standard reaction conditions ' All enzymes and DNAs were from Bethesda Research Laboratories, Inc d Linear form III pBR322 DNA was prepared by incubation of supercoiled form I DNA ... degree of purity of the DNA substrate Improperly prepared DNA samples will be cleaved poorly, if at all, producing partially digested DNA In addition to DNA purity, other DNA- associated parameters ... ENDONUCLEASES 11 Depending upon the subsequent use of the cleaved DNA, the demands on the purity of the DNA may vary Generally, RNA and/ or DNA contamination does not significantly interfere with the...

Ngày tải lên: 11/04/2014, 10:25

531 271 0
recombinant dna part c

recombinant dna part c

... phage DNA into the cell Double-stranded or single-stranded M13 phage DNAs are not infectious and not penetrate the F pili If cells are rendered competent for the uptake of DNA by CAC12,26 phage DNA ... contain the lac DNA in the larger intergenic spaceY v Two Constant and One Variable Primer Recombinant DNA in single-stranded form is useful for exploring gene structure and function and constructing ... techniques to a double-stranded DNA (dsDNA) requires the separation of the two strand of the DNA The singlestranded bacteriophage offers a biological scheme for strand separation The preparation...

Ngày tải lên: 11/04/2014, 10:26

746 226 0
w