pas with the alkyl tail located at the c terminus
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
Ngày tải lên :
23/03/2014, 04:21
... binding isotherm because the protein concentration was too low to detect Table Average site-speci c dissociation constants calculated for EW29Ch with sugar ligands Data obtained at 25 C and pH ... interaction may be an artifact caused by the crystallization of lactose-liganded EW29Ch because: (a) in the other EW29Ch molecule of the crystal structure (each crystal contained two molecules ... subdomain b These results showed that each of the two sugar-binding sites (a and c) of EW29Ch had a distinct chemical exchange on the chemical-shift timescale Site-speci c dissociation constants...
- 11
- 458
- 0
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx
Ngày tải lên :
23/03/2014, 09:20
... SC, S cerevisiae; SP, Schizosaccharomyces pombe Only eukaryotic cytosolic enzymes contain positively charged C- terminal extensions The C- terminal sequence of S cerevisiae and Z mays cytosolic ... peroxisomal matrix proteins [33,34] The observation that yeast (Saccharomyces cerevisiae, Sc) SerRS, like all eukaryotic cytosolic SerRSs, contains a dispensable C- terminal extension that influences the ... interactions Yeast cells were transformed with various constructs as indicated on the right part of the panel, which shows the orientation on the plates that were tested b-Galactosidase activity...
- 12
- 406
- 0
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
Ngày tải lên :
23/03/2014, 13:20
... part of the citrate fermentation operon and accordingly, the oad-2 genes are expressed during anaerobic growth of V cholerae on citrate (data not shown) The catalytic cycle starts with the transfer ... s at 56 C, and 13 30 s at 68 C with Pfu polymerase Before the first cycle the DNA was denatured for at 95 C, and after the last cycle the samples were incubated for an additional at 68 C After ... After cooling to C the PCR products were treated with DpnI for h at 37 C to cut the parental DNA strand by adding the enzyme directly to the PCR mixture After heat inactivation for 10 at 65 °C...
- 10
- 333
- 0
Tài liệu Báo cáo khoa học: Rotary F1-ATPase Is the C-terminus of subunit c fixed or mobile? docx
Ngày tải lên :
19/02/2014, 16:20
... of cK18–cK21 and cD233–cS236 residues The torque was created by external forces acting on the two groups of four carbon atoms each The first group included the Ca atoms of cK18, cI19, cT20 and cK21, ... The calculations indicated that in the crystallographic structure the C- terminal portion of c seems to be tightly clamped within the ‘hydrophobic bearing’ at the top of (ab)3 The steric constraints ... black dots indicate the engineered cysteines aP28 0C and cA28 5C formation of a fluorescent ac cross-link could be prevented only by omitting the reduction/reoxidation cycles altogether These data...
- 9
- 546
- 0
Báo cáo khoa học: Essential role of the C-terminus in Melanocarpus albomyces laccase for enzyme production, catalytic properties and structure pdf
Ngày tải lên :
16/03/2014, 00:20
... mutant, the forward primer 5¢-CGAATCCCTACCCCAAGATCTGAT CGGGCCTGAAGCGTCGCCG-3¢ and the reverse primer 5¢-CGGCGACGCTTCAGGCCCGATCAGATCTTGGGG TAGGGATTCG-3¢ were used Briefly, the mutagenesis was achieved ... 5¢-CCAAGATCGACTCG GGCGCTTAGCGTCGC-3¢; and reverse, 5¢-GCGACGCT AAGCGCCCGAGTCGATCTTGG-3¢ For construction of the Sc(delDSGL559) mutant, the primers used were as follows: forward, 5¢-ACCCCAAGATCTAATCGGGCCTG ... 5¢-ACCCCAAGATCGACTGGGCGG TAAG CGTCGCGCTGGGTGGAGGA-3¢ and 5¢-TCCTCCACC CAGCGGCGACGCTTACCGCCCGAGTCGATCTTGG GGT-3¢ were used as forward and reverse primers, respectively For construction of the Tr(delDSGL559)...
- 16
- 452
- 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx
Ngày tải lên :
17/03/2014, 10:20
... Educacion en el marco del Programa de Modernizacion Tecnologica (BID 802/OC-AR), Consejo Nacional de Investigaciones Cientı´ ficas y ´ ´ Tecnicas (CONICET), Secretarı´ a de Ciencia y Tecnica de ... subjected to hydrolysis in M HCl at 100 C for 12 h, or treated at 37 C with 10 lgÆmL)1 pancreatic carboxypeptidase A Products from both treatments were subjected to twodimensional TLC In each case, ... indicates clearly that the two compounds are incorporated into tubulin at the same site Another biochemical characteristic of tubulin is its ability to act as substrate of the detyrosinating enzyme,...
- 9
- 518
- 0
Báo cáo khoa học: The C-terminus of viral vascular endothelial growth factor-E partially blocks binding to VEGF receptor-1 docx
Ngày tải lên :
23/03/2014, 07:20
... with the following primers: mV-for 5¢ (5¢-CATGGCGCGCCTGATGAAC TTTCTGCTGTCTTGG-3¢) and mV-NZ 2C 3¢ (5¢-CTGAC GCGTGCGGCGTCTTCTGGGCGGCCTTGTGGTCGT CGGTGGCGTGGTTGTGAACTTTGGTCTGCATTCA CATCGGCT-3¢) The ... containing nucleotides 4–368 of ORFVNZ2VEGF was amplified by PCR from viral DNA with the following primers: NZ2-DC 5¢ (5¢-AGCGCCCGGCGCGCCAGA AGTTGCTCGTCGGCATAC-3¢, AscI site underlined) and NZ2-DC 3¢ ... O-glycosylated C- terminus was designated VEGF-A-NZ 2C Role of viral VEGF’s C- terminus in VEGFR binding h The mixture was then transferred to plates coated with VEGF-A and incubated at 25 C for h to capture...
- 11
- 249
- 0
Báo cáo khoa hoc:" Fusion of green fluorescent protein to the C-terminus of granulysin alters its intracellular localization in comparison to the native molecule" pptx
Ngày tải lên :
11/08/2014, 08:20
... extracellular media Thus, the granulysin-GFP fusion construct correctly directs the biosynthesis of the chimeric molecule into the secretory pathway A previous publication demonstrated that a native ... staining with perforin, indicating that the chimera is altered in its subcellular distribution in comparison to the native molecule Conclusions to be drawn from these data regarding the mechanism(s) ... two color immunofluorescent confocal microscopy using a polyclonal antisera reactive to granulysin and a monoclonal antibody reactive to perforin, a well characterized constituent of cytolytic...
- 3
- 269
- 0
Role of the c terminus of protein kinase c related kinase in cell signalling
Ngày tải lên :
14/09/2015, 12:01
... separate and unique functions in the cell 1.3.3.4 Fatty acids In the absence of PS and Ca2+, cis-unsaturated fatty acids such as arachidonic, linoleic, linolenic and oleic acid can activate PKC ... of the receptors Such conformational changes lead to the activation of kinases that are either intrinsic to the receptor or associated with the receptor Thus the signals are transduced from the ... selective activators of PKCδ, ε, η [165, 166] PIP3 was also implicated in the activation of PKCζ [167] Recent evidence demonstrates that PKCζ can be activated by ceramide, which is produced by...
- 240
- 209
- 0
The 11th form non-english majors’ level of satisfaction with their reading comprehension lessons at phan boi chau specialized upper secondary school, nghe an
Ngày tải lên :
07/11/2012, 14:54
... information about students' evaluation of CS necessary for further application Scope of the study Given the time constraint, the study was conducted on the 1st non-English students at NACEC only The ... Memory strategies Cognitive strategies Compensation strategies Indirect strategies Metacognitive Strategies Affective Strategies Social Strategies It can be seen that much of the recent ... Formally practicing with sounds and writing systems: Students practice sounds (pronunciation, intonation, etc) in a variety of ways but not yet in naturalistic communication practice Practicing the writing...
- 46
- 840
- 3
Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3
Ngày tải lên :
07/11/2012, 15:06
... respectively From the discussion, they share their excitement with the author They conclude that the activities so very interesting that they can learn with ease The activities also bring them ... analysis The second describes the data collecting instruments The third provides the data analysis Chapter four focuses on conclusion, which includes the summary of the study, limitations of the study, ... In class: 20 Explain to the class that the concept of time can be very different in different cultures, and that in this activity they are going to compare the concept of time in the UK with the...
- 40
- 644
- 1
TEACHING READING ESP IN INTEGRATION WITH THE OTHER LANGUAGE SKILLS TO STUDENTS OF LINGUSTICS AT UNIVERSITY OF SOCIAL SCIENCES AND HUMANITIES, VIETNAM NATIONAL UNIVERSITY, HANOI
Ngày tải lên :
07/09/2013, 13:45
... particular are still far from being satisfactory To be more exact, the Communicative Approach is not properly applied and reading classes are often used to teach language rather than reading comprehension ... 18 Chart 3.1 The teachers' attitudes toward reading comprehension ………………… 27 Chart 3.2 The students' attitudes toward reading comprehension ………………… 28 Chart 3.3 The teachers’ attitudes toward the ... invaluable advice as well as great help in the completion of this study Secondly, I am also very grateful to my friends, the teachers and the students of linguistics at USSH - VNU for their precious suggestions,...
- 8
- 824
- 10
THE 11TH FORM NON ENGLISH MAJORS’ LEVEL OF SATISFACTION WITH THEIR READING COMPREHENSION LESSONS AT PHAN BOI CHAU SPECIALIZED UP
Ngày tải lên :
07/09/2013, 13:48
... data more accurately .The study was carried out on the basis of material collection, survey questionnaire and class observation For the theoretical basic, materials are collected, gathered and ... students at a specialized school where the requirement and the demand is bigger than at any other school The second difficulty is that the teachers not have chances to contact with native speakers ... province and were selected after an entrance exam in Mathematics, Literature and Specialized subject The reason why the researcher chose these students is that the classes have been assigned with...
- 30
- 367
- 0
difficulties in teaching reading comprehension with the new english textbook “tieng anh 10” (the set of standard textbooks) to the 10th form students at ke sat high school
Ngày tải lên :
29/01/2014, 14:43
... to overcome difficulties - The last part is the Conclusion of the study, which summarises the study, states the limitations of the study and recommendation for further research 1.1 The nature ... input This can help them to be acquainted with the theme and the language relating to the theme From then, the students can speak, listen and write about the things relating to the theme in the next ... elicit them Moreover, in each passage, some sentences with the new grammatical structures of the unit are also introduced This requires the teacher to explain them to the students (quick explanation)...
- 44
- 1.7K
- 8
Tài liệu Báo cáo khoa học: Acetylcholinesterase from the invertebrate Ciona intestinalis is capable of assembling into asymmetric forms when co-expressed with vertebrate collagenic tail peptide doc
Ngày tải lên :
18/02/2014, 17:20
... the WAT domain are indicated by ; the one nonconserved aromatic residue by h The S purpuratus sequence is associated with a putative AChE; the A californica sequence has not been associated with ... interact with ColQ, and come into close contact and stack with the prolines of the PRAD domain (Fig 7C, D) Table Sedimentation coefficients of C intestinalis AChE catalytic subunit co-expressed with ... in the catalytic gorge also supports the assertion that the enzyme is AChE Only one of the 14 aromatic amino acids that line the catalytic gorge of T californica and most other vertebrate AChEs...
- 14
- 581
- 0
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf
Ngày tải lên :
07/03/2014, 10:20
... PCR using speci c primer sets, namely, Hi_pDEDF (5¢-ACGCGTCGACGTCGGA AATGGAGGAGTGACGG-3¢), Hi_pDEDR (5¢-CG GGATCCCGTTAATAAAAGCCTGTTGCTGGTT-3¢), Hi_Nterm F (5¢-ACGCGTCGACGTCATGACTGCTGCT CTGGCCGT-3¢), ... sequence of the caspase-1 gene was introduced using speci c primers (forward, 5¢-CCTGATGCAGGCTA CAGTTCT-3¢; and reverse, 5¢-GCATATGCATGTATT TATTTTTCTTC-3¢) and standard procedures The speci c mutation ... 5¢-GGGGCTTGATCTCAAAATGA-3¢ The caspase-10 gene-speci c primers were: forward, 5¢-GA CGCCTTGATGCTTTCTTC-3¢; reverse, 5¢-ATGAAGGC GTTAACCACAGG-3¢ PCR conditions for these two genes were similar, except...
- 14
- 393
- 0
Báo cáo khoa học: Nitric oxide formation from the reaction of nitrite with carp and rabbit hemoglobin at intermediate oxygen saturations pdf
Ngày tải lên :
16/03/2014, 06:20
... the relative stabilization of the T state versus the R state of Hb (presence and absence of ATP) According to the stoichiometrics for the deoxyHb reaction (Eqns 2,3), the HbNO concentration could ... maximally increase to half of the deoxyHb concentration that was present at the start of the experiment Therefore, because the initial deoxyHb concentration decreased with increasing So2 (i.e at 50% ... lowered by ATP (Fig 6) There are, however, other mechanistic details that contribute to the difference between species This particularly concerns the potential inuence of reaction products from the...
- 13
- 462
- 0
Human resources for industrialization and modernization associated with the development of knowledge based economy in the province of thua thien hue at the present time
Ngày tải lên :
22/07/2014, 18:29
... modernization, Ph.D Thesis in Economics The thesis has researched and resolved theoretical and practical issues: the concept of human, scientific-technological manpower, scientific-technological ... number of scientists to clarify the theoretical and practical issues related to the thesis New scientific contribution of the thesis - Introducing the concept of human resources, human resources for ... industrialization and modernization associated with the development of the knowledge-based economy in Thua Thien Hue with its own specific characteristics of a Province located in the key economic zone...
- 267
- 517
- 0