particle characterization and dynamics

Ngày tải lên: 13/11/2014, 15:58

... Christov and M Marshall, Fuel, 71 (1992) 449 B Klopties, W Hodek and F Bandermann, Fuel, 69 (1990) 448 K.C Pratt and V Christoverson, Fuel, 61 (1982) 460 J.J Llano, R Rosal, H Sastre and F.V Dfez, ... completely deactivated These samples, and samples of fresh unsulfided and sulfided catalyst, were characterized by nitrogen adsorption and SEM The results of textural characterization by nitrogen adsorption ... Hawkins, J.F Fryer and J.G Speight, Fuel, 59 (1980) 647 [11] T Yotono and H Marsh, in H.D Schultz (Editor), Coal Liquefaction Products: NMR Spectroscopic Characterization and Production Processes,...

Ngày tải lên: 23/09/2012, 14:46

... stands up -ing form past tense past participle standing up stood up stood up stand up p.v When you stand up, you change from a sitting position to a standing position Get up is similar to stand ... 216 29 FOCUS ON: phrasal verbs and might, may, and can Possibility: may and might Both may and might are used to express a medium level of possibility When may and might are used to express possibility ... similar to stand up Everyone stands up when the judge enters the courtroom When the students are sleepy, the teacher makes them stand up stand up p.v [informal] When you stand people up, you not arrive...

Ngày tải lên: 01/11/2013, 12:20

... 14 Janice hates her job, and she _ it _ _ her husband 15 I'm San Diego, and I should get there by late afternoon 16 I'll stay in San Diego for a week and then to Los ... require an additional particle when used with an object, As we saw in Section 9, many phrasal verbs that can be used both intransitively and transitively require a second particle when they are ... verbs that share the same verb and first particle as another two-word phrasal verb but have an entirely different meaning These are two different phrasal verbs and are classified separately:...

Ngày tải lên: 01/11/2013, 15:20

... call our coordinate x1 , x2 , and x3 ; and our unit base ˆ ˆ ˆ ˆ ˆ ˆ vectors e1 ,e2 , and e3 we would have A = A1 e1 + A2 e2 + A3 e3 ˆ ˆ ˆ and B = B1 e1 + B2 e2 + B3 e3 and the dot product has the ... x , y , and z axes These x , y , and z axes may be crooked in relation to the x, y, and z axis That is, the x axis need not be parallel to the x axis, the y not parallel to the y axis, and the ... associative, and commutative laws of ordinary addition and multiplication hold Caution: But you cannot divide a vector ˆ by a vector or a scalar by a vector: 7/ı andA/C are nonsense expressions And it...

Ngày tải lên: 25/01/2014, 15:20

... through trial and error, thought and rethought, review and revision, and nine semesters of student testing The first four chapters cover the basics of statics Dynamics of particles and rigid bodies, ... statics vs dynamics, particles vs rigid bodies, and vs vs spatial dimensions Thus a 12 chapter mechanics table of contents could look like this II Dynamics C particles I Statics A particles 1) ... , and k for crooked cartesian coordinates, ˆ r and eθ for polar coordinates, ˆ e ˆ ˆ et and en for path coordinates, and ˆ ‘lambda’ and n as miscellaneous unit vectors ˆ – λ – – – Subscripts and...

Ngày tải lên: 25/01/2014, 15:20

... hypoxantine, guanosine and guanine, uridine and uracil, cytidine and cytosine were 12.2 and 6.2 min, 10.5 and 4.7 min, 15.2 and 6.1 min, 6.8 and 4.2 and 6.6 and 3.9 respectively The amount of purine ... employed and the elution was carried out with : 94 (v v) mixture of 95% methanol and 0.1% triuoroacetic acid in H2O The retention times of adenosine and adenine, inosine and hypoxantine, guanosine and ... A, we were able to calculate the volume of buried and surface cavities for SsCUNH and the template, both in the monomer and in the tetramer, and we found that the volume of buried cavities found...

Ngày tải lên: 18/02/2014, 17:20

... subunit The FP band is not very clear in the agarose gel, and the longest band was used to run another PCR reaction for amplification Experimental procedures Extraction, purification and crystallization ... dyed with Coomassie blue G250, and the four bands corresponding to subunits of porcine complex II were cut out and N-terminal sequenced by the Edman degradation method and amino acid analyzer in ... modulate the interaction between membrane protein and detergent Results and Discussion The mitochondrial respiratory complex II preparation was extracted and purified from porcine heart The major purification...

Ngày tải lên: 19/02/2014, 02:20

... (Eqn 2) On the other hand, compounds 1, 4, and are noncompetitive inhibitors, and compounds and are competitive inhibitors with respect to NADP Table summarizes the IC50 values and kinetic inhibition ... a-helix, b-sheet, b-turn, and random coil in HpSDH are, respectively, 16.6, 49.2, 1.5, and 32.6% processed by jasco secondary structure estimation software The percentage for random coil of HpSDH is ... HpSDH and the effects of pH and temperature on HpSDH The results show that HpSDH has a kcat of 7.7 ± 0.9 s)1, Km of 0.148 ± 0.028 mm and kcat ⁄ Km of 5.2 · 104 m)1Æs)1 toward shikimate, and a...

Ngày tải lên: 19/02/2014, 05:20

... 0.1% TFA in water and 20% of 0.1% TFA in 40% acetonitrile Excitation and emission wavelengths of the fluorescence detector were set at 450 and 525 nm, respectively FAD and FMN standards were used ... CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG MfeI and PstI sites were inserted in forward and reverse primers, respectively, upstream and downstream the start and the stop codons, whereas a (His)6coding ... The amplified DNA was digested by MfeI and PstI and ligated into the ampicillin-resistant expression vector pSD80 [43], which was digested by EcoRI and PstI, and introduced by electroporation in...

Ngày tải lên: 19/02/2014, 06:20

... and the cysteine residues alkylated in order to verify their identification Although there are standard procedures for reduction and alkylation, their application to conopeptide analysis and characterization ... a-conotoxins and two disulfide bonds (identified by partial reduction and alkylation studies and MS/MS) It may also include diagnostic LC/MS for recognition of some posttranslational modifications and possibly ... the muscle-acting a-conotoxins GI and GII together with the neuronally acting a-conotoxins GIC and GID [1,5,10] and C magus venom contains the 2296 M L Loughnan and P F Alewood (Eur J Biochem 271)...

Ngày tải lên: 19/02/2014, 12:20

... and frequency change in MZEE between t and year u = t + i Initial frequency and dissemination in MZEE In studying the fate of all words in two English Usenet corpora, Altmann, Pierrehumbert and ... Hock and Brian D Joseph 1996 Language history, language change, and language relationship: An introduction to historical and comparative linguistics Berlin, New York: Mouton de Gruyter Andrew ... of two prefixes and/ or three suffixes Our list of affixes was built 136 from commonly-affixed stems in the MZEE corpus and a German grammar (Fagan, 2009) Compound-cutting Nominal and adjectival compounding...

Ngày tải lên: 19/02/2014, 19:20

... sequence is closer to human and pufferfish (torafugu and spotted green pufferfish) IL-10 sequences Pufferfish and carp IL-10 genes, clustered together and distant from IL-20 and IL24, as recently determined ... Using Parsimony ( *and Other Methods), 4th edn Sinauer Associates, Sunderland, Massachussetts 24 Laing, K.J., Holland, J., Bonilla, S., Cunningham, C & Secombes, C.J (2001) Cloning and sequencing ... homologues and the torafugu IL-10 genomic sequence, we isolated a clone of 440 bp (resembling mammalian IL-10) from carp head kidney cells stimulated with LPS and concanavalin A [18] The 5¢ and 3¢...

Ngày tải lên: 20/02/2014, 02:21

... aspartate residues (Asp239 and Asp260, PelB numbering), as well as the residues Asp261 and His296, believed to be of importance in the catalytic process, and Arg327 and Lys329, which may play ... 1BHE) and T maritima (small characters, derived from model based upon E carotovora 1BHE in the program 3D-PSSM) [28], for which E (e) indicates strand and H (h) helix The parallel b-strands (PB1, ... obtained from ICN (Zoetermeer, the Netherlands) Saturated oligoGalpA (DP 28) and unsaturated oligoGalpA (DP 37) were prepared and puried from polygalacturonase and pectin lyase digestions as described...

Ngày tải lên: 20/02/2014, 03:20

... some sera to a 9- and a 15-kDa band We could show that the 9-kDa band in the tomato extracts reacts with a specific antibody against the LTP from cherry, Pru av and the 15-kDa band shows reactivity ... nitrogen, and ground in a mill without thawing The obtained powder was homogenized in prechilled acetone and stored overnight at )20 °C The precipitate was filtered, washed twice with icecold acetone and ... Karlsruhe, Germany) and proteins were separated by SDS/ PAGE using a 10% resolving gel with 1.5-mm spacers Desired bands were excised from the gel after staining with 0.3 M CuCl2 and the protein...

Ngày tải lên: 21/02/2014, 00:20

... cm)1 and ms (PO2–) at 1120 cm)1, respectively [23,30], and the bands at Fig Infrared spectrum in the spectral range 1800–900 cm)1 (A) and – in the range of the negatively charged phosphate band ... by treatment with DNAse/RNAse and proteinase K, and lyophilized and used in the natural salt form The lipopeptide palmitoyl-3-cysteine-serine-lysine-4 (Pam3CSK4) and the macrophage-activating ... hydrated PC, MfGl-II, and LPS Re 1172, 1085, and 1038 cm)1 assigned to glucose ring vibrations [31] As no additional bands in the range of the amide vibrations centered at 1650 and 1550 cm)1 can...

Ngày tải lên: 21/02/2014, 00:20

... Asn117, Tyr287 and Arg311), and the two Cys residues (105 and 186) that form a disulfide bond between EL1 and EL2 to maintain the receptor in a high affinity conformational state Several Ser and Thr residues ... positions (3 and 10), while xTRHR2 had these sites at positions and 12 The glycosylation site in EL2 (Asn167 for xTRHR1 and Asn172 for xTRHR2) and the two homologous Cys residues (335 and 337 for ... intestine (lane 10) and dorsal skin (lane 11) Rat testis (lane 1) and ovary (lane 2) were used as positive and negative controls, respectively TM7 (in Xenopus and mouse TRHR1) [41] Tyr106 and Asn110 have...

Ngày tải lên: 21/02/2014, 03:20

... the cytosolic and membrane-bound forms of yeast PtdEtn-PLD and examined the regulation of PtdEtn-PLD activity under certain growth, nutritional and stress conditions MATERIALS AND METHODS Chemicals ... (I+) and/ or mM choline (C+) Other amino acidrich media included: YPD [yeast extract and Bactopeptone (YP) containing 2% dextrose]; YPA (YP containing 0.05% glucose and 2% potassium acetate); and ... 2002 Characterization and regulation of yeast PtdEtn-PLD activity (Eur J Biochem 269) 3823 Table Effect of different divalent cations on cytosolic and membranebound PtdEtn-PLD activity Cytosolic and...

Ngày tải lên: 22/02/2014, 07:20

... probe and a simple pulseacquire sequence (30° pulses for 1H and 31P and 90° pulse for 13C) Several 2D spectra were also recorded using standard Bruker parameters NMR data for ThDP, AThDP, ThTP and ... 500 ⁄ 125 ⁄ 202.5 MHz in D2O at pH 7.4 and 25 °C TMS and H3PO4 were used as references ThDP was a commercial preparation (Sigma-Aldrich), and ThTP, AThDP and AThTP were synthesized as described ... and m ⁄ z 257.1 We were unable to assign the latter ion, which is obtained after fragmentation of both AThTP and AThDP and probably results from a molecular rearrangement NMR data for AThTP and...

Ngày tải lên: 07/03/2014, 01:20

... cell lysates (C) and 50 lL of medium (M) of HT1080 and HT1080-Scpep1 were separated by SDS-PAGE, blotted and probed with the a-His antibody and the a-Scpep1 antisera from rabbit and rat, respectively ... high transcript levels in kidney and aorta in rat and lower levels in heart, spleen and lung, whereas the human transcript was detected strongly in the kidney and heart but at a low level in a ... transferase) and urine parameters showed no pathological findings The activities of several lysosomal hydrolases were normal in various tissues and lysosomes from liver and kidney of Scpep1-gt mice, and...

Ngày tải lên: 07/03/2014, 03:20