part c compression transfer and injection molding of specialty elastomers

Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

... 21°CA bTDC of injection timing and 230 bar of injection pressure Similarly the brake thermal efficiency was lower at 21°CA bTDC of injection timing and 230 bar of injection pressure The oxides of ... at 21° CA bTDC of injection timing and 230 bar of injection pressure except for NOX The ignition delay is neither minimum nor maximum at 21° CA bTDC of injection timing and 230 bar of injection ... thermal efficiency (%) Figure Variation of brake specific fuel consumption with injection pressure at different injection timings 23 (°CA bTDC) 21 (°CA bTDC) 19 (°CA bTDC) 17 (°CA bTDC) 29.5 29.0...

Ngày tải lên: 05/09/2013, 16:11

10 552 0
Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx

Tài liệu Báo cáo khoa học: DNA strand exchange activity of rice recombinase OsDmc1 monitored by fluorescence resonance energy transfer and the role of ATP hydrolysis pptx

... sequences: PhiC: 5¢-CGATACGCTCAAAGTCA AAATAATCAGCGTGACATTCAGAAGGGTAATAAG AACG-3¢;, PhiW: 5¢-CGTTCTTATTACCCTTCTGAA TGTCACGCTGATTATTTTGACTTTGAGCGTATCG-3¢ and M1 3C: 5¢-CTACAACGCCTGTAGCATTCCACAGA CAGCCCTCATAGTTAGCGTAACGAGATCG-3¢ ... identified DMC1 gene in Saccharomyces cereveciae, which had sequence similarities with recA and RAD51 ScDMC1 mutants showed defective reciprocal recombination, accumulation of double strand breaks and ... of RecA in eukaryotes using classical biochemical techniques, which did not yield much success Introduction of molecular techniques led to identification of two RecA homologues, namely Rad51 and...

Ngày tải lên: 19/02/2014, 07:20

10 569 0
Báo cáo khoa học: Knock-out of the chloroplast-encoded PSI-J subunit of photosystem I in Nicotiana tabacum PSI-J is required for efficient electron transfer and stable accumulation of photosystem I pot

Báo cáo khoa học: Knock-out of the chloroplast-encoded PSI-J subunit of photosystem I in Nicotiana tabacum PSI-J is required for efficient electron transfer and stable accumulation of photosystem I pot

... thaliana (ARATH) and Nicotiana tabacum (TOBAC)], algae [Chlamydomonas reinhardtii (CHLRE) and Porphyra purpurea (PORPU)] and cyanobacteria [Synechcoccus elongatus (SYNEL) and Prochlorococcus marinus ... Super-Signal, Pierce, Rockford, IL, USA) according to the instructions of the manufacturer The chemiluminescent signal produced was recorded digitally using a cooled CCD camera with the AC1 AutoChemi System ... oxidized Pc stays longer in the active site and thereby blocks efficient exchange with reduced Pc Alternatively, the changed conformation of PSI-F in the absence of PSI-J could affect proper functioning...

Ngày tải lên: 16/03/2014, 11:20

13 382 0
Báo cáo khoa học: "DEALING WITH INCOMPLETENESS OF LINGUISTIC KNOWLEDGE IN LANGUAGE TRANSLATION TRANSFER AND GENERATION STAGE OF MU MACHINE TRANSLATION PROJECT" potx

Báo cáo khoa học: "DEALING WITH INCOMPLETENESS OF LINGUISTIC KNOWLEDGE IN LANGUAGE TRANSLATION TRANSFER AND GENERATION STAGE OF MU MACHINE TRANSLATION PROJECT" potx

... Area restriction by using field code, such as electrical Engineering, nuclear science, medicine, and so on (2) Semantic code attached to a word in the analysis phase is used for the selection o ... System (GRADE) of Mu-Machine Translation Project and its Charactersitics, Proc of COLING 84, 1984 [3] J Tsujii, et al.: Analysis Grammar of Japanese in the Mu-Project A Procedural Approach to Analysis ... same subject nouns is done in compound and complex sentences ( v ) Duplication of a head noun in the conjunctive noun phrase is eliminated, such as, "uniform component and non-uniform component"...

Ngày tải lên: 31/03/2014, 17:20

8 326 0
báo cáo khoa học: "Cellular transfer and AFM imaging of cancer cells using Bioimprint" pdf

báo cáo khoa học: "Cellular transfer and AFM imaging of cancer cells using Bioimprint" pdf

... procedures for biological atomic force microscopy J Microscopy 2005, 218(3):199-207 Hayat MA: Principles and Techniques of Electron Microscopy: Biological Applications: Ch.1–3,6,7 4th edition Cambridge ... cells were cultured in accordance with institutional guidelines of the Christchurch School of Medicine and Health Sciences, University of Otago, New Zealand, after ethical approval and appropriate ... This combined physical and chemical approach may yield a better understanding into cell functionality and mechanics Artifacts in the form of bubbles caught trapped between the cell and polymer and...

Ngày tải lên: 11/08/2014, 00:22

10 263 0
Báo cáo y học: " Horizontal gene transfer and the evolution of transcriptional regulation in Escherichia col" ppt

Báo cáo y học: " Horizontal gene transfer and the evolution of transcriptional regulation in Escherichia col" ppt

... E coli K12 araBDA ?C Vibrio parahaemolyticus RIMD 2210633 Score Site sequence -175 9.1 aAgTGTGccgtagtTCACgaTc -148 10.3 aAaTagGAtctagaTCACAaaa -131 9.1 ttaTtTGcacggcgTCACAcTt -177 6.3 tggaGTtcgatgagagcCggTt ... tggaGTtcgatgagagcCggTt -137 6.5 cgacaTGAtgacgacgAtcgcc gntKU E coli K12 -171 13.1 aAaTtTGAagtagcTCACAcTt gntK-edd V cholerae -131 11.5 gttTGTGttatagcTCACAtTt These E coli operons are regulated by CRP as ... presumably occurs because CRP regulates carbon source choice and because many of the HGT genes encode the catabolism of specific carbon sources (At a false discovery rate of 5%, none of the other global...

Ngày tải lên: 14/08/2014, 08:20

20 311 0
Part 1 total synthesis and biological evaluation of antillatoxin and fragments part II synthetic studies towards the total synthesis of cytochalasans and tuberostemonine

Part 1 total synthesis and biological evaluation of antillatoxin and fragments part II synthetic studies towards the total synthesis of cytochalasans and tuberostemonine

... calculated cat catalytic Cbz benzyloxycarbonyl CDCl3 deuterated chloroform COSY correlated spectroscopy Cp cyclopentadienyl CSA camphorsulfonic acid CH2Cl2 dichoromethane CHCl3 chloroform cm -1 inverse ... inverse centimeter cyc cyclohexane; cyclohexenyl d doublet DABCO 1,4-diazabicyclo[2.2.2]octane ix dba dibenzylidene acetone DBU 1,8-diazabicyclo[5.4.0]undec-7-ene DCC 1,3-dicyclohexylcarbodiimide ... cycloaddition reaction OBn OBn MeO 2C + EtO 2C BF3.OEt2 CO2Me CHO CH2Cl2 -78 C to -60 C CHO CO2Et 81 ratio 4(Z):1(E) 23 88a 22% (91:9) The regiochemistry and relative stereochemistry of the cycloadducts...

Ngày tải lên: 16/09/2015, 08:31

293 550 0
Organic Poultry and Eggs Capture High Price Premiums and Growing Share of Specialty Markets pptx

Organic Poultry and Eggs Capture High Price Premiums and Growing Share of Specialty Markets pptx

... national organic standards address the methods, practices, and substances used in producing and handling crops, livestock, and processed agricultural products Although specific practices and materials ... be purchased by consumers and can steer consumers toward purchasing other organic products, such as cereals and snacks Drivers of the growth in consumer demand for organic meat include concerns ... which can account for up to 70 percent Organic Poultry and Eggs Capture High Price Premiums and Growing Share of Specialty Market / LDP-M-150-01 Economic Research Service/USDA of the cost of raising...

Ngày tải lên: 08/03/2014, 09:20

18 488 0
Tài liệu Handbook of SPECIALTY ELASTOMERS pptx

Tài liệu Handbook of SPECIALTY ELASTOMERS pptx

... 3,4-Dichlorobutene-1 Monovinyl-acetylene CH—CH2Cl Isomerization 2-Chlorobutadiene -1,3 (b.p 59.4 C) Cl — +HCl CH2 = C CH = CH2 = — CH= C CH = CH2 CH—CH2— Cl cis- and trans-1.4Dichlorobutene-2 −HCl Chloroprene Advantage ... Name: BMani Handbook of Specialty Elastomers Acetylene process (1930) Acetylene = CH — CH Butadiene process (1960) Butadiene CH2 = CH — CH = CH2 + Cl2 — CHCl — CH2Cl CH = CH2 3,4-Dichlorobutene-1 ... (H/H) (CH ) ~ 2— CH = C CH2)−(CH2— C = CH— CH2 ~ — (H ) ~ 2C C = CH— CH2)−(CH2— CH = C CH2 ~ Cl Cl — (V) Tail-to-tail (T/ T) FIGURE 1.3 Structural units in the polychloroprene chain (typical commercial...

Ngày tải lên: 19/02/2014, 09:20

572 920 2
Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

... result, the exact prevalence of which is unknown Int J Med Sci 2006, Chronic hepatitis C In patients with clinical or biological signs of chronic liver disease, chronic hepatitis C is certain when ... the presence or absence of either marker The presence of HCV RNA in the absence of anti-HCV antibodies is strongly indicative of acute HCV infection, which will be confirmed by seroconversion ... undetectable, due to transient, partial control of viral replication by the immune response before replication escapes and chronic infection establishes [14] Apart from such cases, the presence of...

Ngày tải lên: 02/11/2012, 09:56

6 612 0
Exergoeconomic performance optimization of an endoreversible intercooled regenerated Brayton cogeneration plant Part 1: Thermodynamic model and parameter analyses

Exergoeconomic performance optimization of an endoreversible intercooled regenerated Brayton cogeneration plant Part 1: Thermodynamic model and parameter analyses

... compressor: yc2 c3 EI TI (c1 c4 − c4 + yER ) + x( y − c4 ER )( ELTL + c3 EK TK ) + xc 1c2 c3 EH TH x[ y − c4 ER + yc2 c3 c5 (c4 − c1 c4 − yER )] T1 = (16) where c1 = 2(1 − ER ) , c2 = − EK , c3 = − EL , c4 ... are counter-flow The conductances (heat transfer surface area and heat transfer coefficient product) of the hot-, cold- and consumer-side heat exchangers, the intercooler and the regenerator are ... effect of ER on the characteristic of (π )Π opt is similar to that of ER versus π It indicates that opt (π )Πopt increases with the increase of ER Figure Effects of ER on the characteristics of...

Ngày tải lên: 05/09/2013, 14:58

12 495 0
An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

An experimental investigation of heat transfer and fluid flow in a rectangular duct with inclined discrete ribs

... mm which consists of entrance section, test section and exit section of lengths of 800 mm, 1200 mm and 600 mm respectively according to the guidelines of ASHARAE standard [20] A mm thick Aluminum ... can be modified by using the laser sheet optics containing spherical and cylindrical lenses A high performance (CCD) camera is used to record the motion of the particles moving in the plane of ... significantly the heat transfer and friction characteristics of the duct The literature review reveals that the discrete inclined rib arrangement yields better performance as compared to continuous...

Ngày tải lên: 05/09/2013, 16:10

12 831 0
Theoretical modeling of combustion characteristics and performance parameters of biodiesel in DI diesel engine with variable compression ratio

Theoretical modeling of combustion characteristics and performance parameters of biodiesel in DI diesel engine with variable compression ratio

... ε compression ratio, L connection rod length (m), S stroke (m) 3.2 Calculation of specific heat The specific heat at constant volume and constant pressure for each species is in kJ/kg.K and calculated ... the start of combustion is then computed assuming adiabatic compression of the unburned charge according to: ⎛ p ⎞ Tu = TSOC ⎜ ⎜p ⎟ ⎟ ⎝ SOC ⎠ γ −1 γ (25) where TSOC & PSOC temperature and pressure ... gas exchange period: C1 =6.18; C2 =0 For compression period: C1 =2.28; C1 =0 For the combustion and expansion period: C1 =6.18; C2 =3.24*10-3 up average piston speed (m/s), Pcyl pressure of cylinder...

Ngày tải lên: 05/09/2013, 16:11

12 666 2
Tài liệu Root Finding and Nonlinear Sets of Equations part 2 docx

Tài liệu Root Finding and Nonlinear Sets of Equations part 2 docx

... to trade@cup.cam.ac.uk (outside North America) a x2 x3 b x1 d c f e 351 9.1 Bracketing and Bisection 352 Chapter Root Finding and Nonlinear Sets of Equations #include #define FACTOR 1.6 ... expands the range geometrically until a root is bracketed by the returned values x1 and x2 (in which case zbrac returns 1) or until the range becomes unacceptably large (in which case zbrac returns ... guaranteed to converge: Local behavior might send it off towards infinity Sample page from NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge...

Ngày tải lên: 15/12/2013, 04:15

5 452 0
Tài liệu Root Finding and Nonlinear Sets of Equations part 3 pptx

Tài liệu Root Finding and Nonlinear Sets of Equations part 3 pptx

... out of its brackets Second, the convergence of successive applications of equation (9.2.4) is quadratic, that is, m = in equation (9.1.4) Since each application of (9.2.4) requires two function ... NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright (C) 1988-1992 by Numerical Recipes Software ... NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright (C) 1988-1992 by Numerical Recipes Software...

Ngày tải lên: 15/12/2013, 04:15

6 374 0
Tài liệu Root Finding and Nonlinear Sets of Equations part 4 doc

Tài liệu Root Finding and Nonlinear Sets of Equations part 4 doc

... NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright (C) 1988-1992 by Numerical Recipes Software ... solution off to limbo, with vanishingly small hope of recovery Sample page from NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge ... RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright (C) 1988-1992 by Numerical Recipes Software Permission...

Ngày tải lên: 15/12/2013, 04:15

4 382 0
Tài liệu Root Finding and Nonlinear Sets of Equations part 5 doc

Tài liệu Root Finding and Nonlinear Sets of Equations part 5 doc

... polynomial Consequently, the roots can become more and more inaccurate It matters a lot whether the inaccuracy creeps in stably (plus or Sample page from NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING ... NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright (C) 1988-1992 by Numerical Recipes Software ... be shot off not to infinity, but — by luck — right into the basin of convergence Sample page from NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992...

Ngày tải lên: 15/12/2013, 04:15

8 383 0
Tài liệu Root Finding and Nonlinear Sets of Equations part 6 docx

Tài liệu Root Finding and Nonlinear Sets of Equations part 6 docx

... NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright (C) 1988-1992 by Numerical Recipes Software ... NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright (C) 1988-1992 by Numerical Recipes Software ... eps) Given n+1 coefficients p[0 n] of a polynomial of degree n, and trial values for the coefficients of a quadratic factor x*x+b*x +c, improve the solution until the coefficients b ,c change by less...

Ngày tải lên: 15/12/2013, 04:15

11 385 0
Tài liệu Root Finding and Nonlinear Sets of Equations part 7 doc

Tài liệu Root Finding and Nonlinear Sets of Equations part 7 doc

... values xi and F denote the entire vector of functions Fi In the neighborhood of x, each of the functions Fi can be expanded Sample page from NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING ... NUMERICAL RECIPES IN C: THE ART OF SCIENTIFIC COMPUTING (ISBN 0-521-43108-5) Copyright (C) 1988-1992 by Cambridge University Press.Programs Copyright (C) 1988-1992 by Numerical Recipes Software ... Globally Convergent Methods for Nonlinear Systems of Equations 383 such methods can still occasionally fail by coming to rest on a local minimum of F , they often succeed where a direct attack via...

Ngày tải lên: 15/12/2013, 04:15

5 329 1
w