oxidative stress in alzheimers disease hippocampus a topographical study

... Helkala EL, Laakso MP, Hanninen T, Hallikainen M, Alhainen K, Soininen H, Tuomilehto J, Nissinen A: Midlife vascular risk factors and Alzheimer's disease in later life: longitudinal, population ... hypothesis in Alzheimer's disease. Free Radic Biol Med 1997, 23:134-147. 27. Shimohama S, Tanino H, Kawakami N, Okamura N, Kodama H, Yamaguchi T, Hayakawa T, Nunomura A, Chiba S, Perry G, Smith MA, Fujimoto ... findings suggest that oxidative damage ema- nating from the reactive microglia and astrocytes adjacent to senile plaques may play an early role in the pathogene- sis of AD. Several potential sources...

Ngày tải lên: 19/06/2014, 22:20

... dismutase and catalase activities in the hippocampus of adult rats after pilocarpine-induced SE Table 1 shows superoxide dismutase and catalase activ- ities in the hippocampus after seizures and SE induced by ... concentration, and super- oxide dismutase and catalase activities in the hippocampus of adult rats after SE induced by pilocarpine. Results Behavioral alterations after treatment with pilocarpine According ... several changes in variables related to the generation and elimination of oxygen free radicals in adult rats [18,30]. An increase in free radical formation is accompanied by an imme- diate compensatory...

Ngày tải lên: 19/02/2014, 16:20

... CTAGCTGGTGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATAT 5Â anking reverse GGCCGAGGAGCAGGACTGAGAATTCTTTGCGGTCTTCCTGAAGCTGACCACTGT 3Â anking forward CATTGTTTGAGGCGAATTCGATATCGAGGCTCAGAACCTCCCTGCGCAGACGCG 3Â anking reverse ... GGCCTCCCTAAGCTTCTGGACCTTTTCGCGTGTTGCTTCCGACATAGGAACGAG zeocinpyrG forward GAATTCTCAGTCCTGCTCCTCGGCC zeocinpyrG reverse GATATCGAATTCGCCTCAAACAATG Nested forward GAGACCTAGGAAGCAATGTCTCCGCAACATTTGGCGACATGGTCTCATAT Nested ... CGCTGGCGAACACATTATATGA pes1 E1-C1 reverse ACGAATTACTTGCAGCCGCTT sidD forward ACGCAACCGACTGGTTGTT sidD reverse ATTCGTGCGAGACTCGGAT Calmodulin forward CCGAGTACAAGGAAGCTTTCTC Calmodulin reverse GAATCATCTCGTCGACTTCGTCGTCAGT Aspergillus...

Ngày tải lên: 30/03/2014, 10:20

... and absorbance immediately read at 450 nm. Oxidized pro- tein standards, internal controls and blanks were always assayed at the same time and in the same way. All samples were always determined ... Corresponding author Abstract Background: An increasing body of evidence implicates both brain inflammation and oxidative stress in the pathogenesis of Alzheimer's disease (AD). The relevance ... occurs. Inflammatory mechanisms are also operative in the AD brain and significantly contribute to the pathophysiology of the disease. Although classical defined inflammation, including such features...

Ngày tải lên: 19/06/2014, 22:20

... shows activities of AS, AL and arginase in the study. AS and AL activities increased in all the three brain regions significantly in anoxia suggesting an increased utilization of citrulline ... thiobarbituric acid reactive substances and decreased total antioxidant status indicate the presence of oxidative stress in anoxia and reperfusion. The increased arginase and sustained decrease of GS activity ... may also serve as a substrate for glutamate formation and may also provide increased substrate for arginase (50). No significant changes in the activity of arginase in the anoxic group indicate...

Ngày tải lên: 26/10/2012, 09:07

... Ca 2+ paradox Paradoxical Ca 2+ increases were originally described in isolated heart preparations [195] and subsequently shown to be associated with tissue damage in this and other organs, including ... dehydrogenase complex in rat brain. J Comp Neurol 346, 461–479. 86 Park LC, Calingasan NY, Sheu KF & Gibson GE (2000) Quantitative alpha-ketoglutarate dehydrogenase activity staining in brain sections ... concentration, termed ‘Ca 2+ paradox’. The free extracellular calcium concen- tration falls dramatically in several brain disease states: (a) during or after ischemia (0.1–0.28 mm [186–189]); (b) traumatic...

Ngày tải lên: 07/03/2014, 12:20

... catalytically independent domains, the N-terminal domain, display- ing ALDH activity, and the C-terminal domain, con- taining an iron-binding domain, which is involved in ADH activity. The integrity ... and pathway fluxes in live parasites. Results Kinetic characterization of EhPFOR in amebal extracts PFORs in several anaerobic parasites have been found attached to plasma and hydrogenosomal membranes [20,21], ... stress in Entamoeba histolytica Erika Pineda 1 , Rusely Encalada 1 , Jose ´ S. Rodrı ´ guez-Zavala 1 , Alfonso Olivos-Garcı ´ a 2 , Rafael Moreno-Sa ´ nchez 1 and Emma Saavedra 1 1 Departamento de...

Ngày tải lên: 15/03/2014, 23:20

... genes regulating peroxisomal and microsomal oxidation pathways was analyzed by RT-PCR. In addition, glutathione peroxidase and catalase activities, as well as thiobarbituric acid reactive substances, ... aggravate hepatic damage. Further evidence is the significant increase in catalase activity observed after fasting in mice fed with the MCT diet. Catalase is localized in peroxisomes, and traps ... KO mice. Catalase activity Similar results were obtained for catalase activity, as shown in Fig. 5. With LCT and fasting, catalase activ- ity significantly increased up to 320.4 17.8 and 515.8...

Ngày tải lên: 15/03/2014, 23:20

... E, Kisara S, Nakano S, Murata R, Tanaka Y, Sakaguchi S, Takayanagi M, Takayanagi Y, Sasaki K: Mechanism of resistance to oxidative stress in doxorubicin resistant cells. Biol Pharm Bull 2001, ... sus- tained JNK activation associated with decreased protein levels of MKP1, one of MAP kinase phosphatases that inactivate JNK and p38 MAP kinases [2]. Interestingly, NSC-741909 induced an increase ... dephosphorylation through a group of MAP kinase phosphatases [3]. MAP kinase phosphatases (MKPs) are a group of dual-specificity phosphatases that inactivate MAPKs by dephosphorylating their threonine and...

Ngày tải lên: 18/06/2014, 16:20

... sense 5'-GATGTGTGGAGCACGCTTACT-3' and antisense 5'-CACAATGTCACTCCTCTCCGAATTA-3', Catalase (763 bp): sense 5'-TTACTTTCTTGTTCAGCGAC CGA-3' and antisense 5'-C ACCTTCGTATAGAATGTCCG CA-3', ... ACCTTCGTATAGAATGTCCG CA-3', Cu/Zn-SOD (541 bp): sense 5'-AGGATTAACTGA AGGCGAGCATG-3' and antisense 5'-GCCCAAGTCATC TTGTTTCTCGT-3', MTH1 (169 bp): sense 5'-AGCCTCA GCGAGTCTCCTG-3' ... measure PM-induced oxidative DNA damage, single strand DNA breakage assay was performed according to Nampalli et al .’s method [20]. Briefly, 2 à g of pBR322 DNA (TaKaRa, Japan) was suspended in 50 à l...

Ngày tải lên: 07/08/2014, 17:22

... photorespiratory pathway) in Pinus taeda needles exposed to air pollution. As a shade tolerant, slow growing species [3], sugar maple has a low assimilation rate, leading to a compromise be- tween maximizing ... repair of injured foliar tissues. As PEPC transformed PEP to OAA and as PEPC activity increased with increasing O 3 , the PEP availability may have decreased. Thus the amount of PEP, which is a ... the tricarboxylic acid cycle may have increased with increasing O 3 whereas its allocation to the shikimate pathway may have decreased. The NR activity was decreased by more than two-fold dur- ing...

Ngày tải lên: 08/08/2014, 00:22

... patients evaluated at baseline were evaluated again after 14 days of treatment with nifedipine (60 mg/day) both for a cardiac study and for the present biological evaluation. The second evaluation was ... chlo- ramine-T equivalents. Statistical analysis Data were analysed with the following nonparametric sta- tistical methods: Mann–Whitney (unpaired data) and Wil- coxon (paired data) tests for comparison ... Lemaréchal 2 , Ohvanesse Garabed Ekindjian 2 and André Kahan 1 1 Paris V University, Department of Rheumatology A, Assistance Publique Hôpitaux de Paris, Cochin Hospital, Paris, France 2 Department...

Ngày tải lên: 09/08/2014, 01:23

... dysfunction and degeneration in cartilage. The findings of the present study suggest that cumulative oxidative stress leads to a decrease in antioxidative capac- ity in articular cartilage, resulting in ... statistically significant. Results Oxidative damage in human articular cartilage tissues To determine whether oxidative damage was present in OA degenerated cartilage, we measured the antioxidative potential of the intact ... chondrocytes and articular cartilage explants were isolated from knee joints of patients undergoing arthroplastic knee surgery for OA. Oxidative damage and antioxidative capacity in OA cartilage were investigated...

Ngày tải lên: 09/08/2014, 06:22

... Natsuizaka M, Ozasa M, Darmanin S, Miyamoto M, Kondo S, Kamada S, Shindoh M, Higashino F, Suhara W, Koide H, Aita K, Nakagawa K, Kondo T, Asaka M, Okada F, Kobayashi M: Syner- gistic up-regulation ... disability that affects diarthrodial joints, being characterized by cartilage degradation, accompa- nied by local inflammation and changes in the subchondral bone. Increasing age, excessive loading ... housekeeping gene product as an inter- nal control. The intensity of the bands was analyzed using ImageQuant™ TL (GE Healthcare). Total RNA extraction and quantitative real-time RT-PCR Total RNA was...

Ngày tải lên: 09/08/2014, 14:21

Ngày tải lên: 10/08/2014, 10:20

Ngày tải lên: 10/08/2014, 10:20

Ngày tải lên: 11/08/2014, 07:21

Ngày tải lên: 11/08/2014, 08:22

Ngày tải lên: 12/08/2014, 12:20

Ngày tải lên: 12/08/2014, 16:20