... 258 Rajinder Raina et al Table Effects of chronic dermal application of cypermethrin on enzymes, blood glutathione andlipidperoxidation in Wistar rats Days after dermal application Parameters ... significant changes in GST activity was seen up to 30 days, but thereafter, a significant increase was noticed up to 120 days There was significant decrease in the GSH after 30 days and similar pattern ... 120 days (p < 0.05) Significant increase in lipidperoxidation indicated lipid membrane damage from 30 days onward Pyrethroids are metabolized in liver via cytochrome P450 oxidative pathways yielding...
... apoptosis in primary human small airway epithelial cells (SAEC) Primary human small airway epithelial cells (SAEC) were treated with media alone (control) and various concentrations of CSE; a) ... Live; A = Apoptosis; N = Necrosis References Kode A, Yang SR, Rahman I: Differential effects of cigarette smoke on oxidativestressand proinflammatory cytokine release in primary human airway epithelial ... chromatin condensation, whereas necrotic or late apoptotic cells had normal/condensed nuclei that were brightly stained with ethidium bromide and appeared red Percentage of viable (white bars), apoptotic...
... as a therapeutic strategy Pharmacol Ther 2006, 111:476-494 Rahman I, Biswas SK, Kode A: Oxidant and antioxidant balance in the airways and airway diseases Eur J Pharmacol 2006, 533:222-239 Marwick ... data showed that CSE caused oxidativestress in a variety of alveolar epithelial cell lines as well as in primary human small airway epithelial cells However, CSE triggered NF-κB activation and ... Rahman I, Gilmour PS, Jimenez LA, Biswas SK, Antonicelli F, Aruoma OI: Ergothioneine inhibits oxidative stress- and TNF-alphainduced NF-kappa B activation and interleukin-8 release in alveolar...
... Elena Cristina Crăciun, R Morar, Dana Liana Pusta, Fazakas Zita, Szőcs-Molnár Terézia, Dunca Iulia, Sánta Dóra and Minodora Dobreanu Chapter 13 Diabetes, Oxidative Stress, Antioxidants and Saliva: ... States, OxidativeStressand Cellular Damage 413 Cano-Europa, Blas-Valdivia Vanessa, Franco-Colin Margarita and Ortiz-Butron Rocio Chapter 19 OxidativeStress in Human Autoimmune Joint Diseases ... Mar a Cristina Islas Carbajal and Ana Rosa Rincón Sánchez Chapter Role of Oxidized Lipids in Atherosclerosis 119 Mahdi Garelnabi, Srikanth Kakumanu and Dmitry Litvinov Chapter Oxidative Damage...
... placenta of women with preeclampsia Placenta 2009, 30:342–347 195 Sharma JB, Sharma A, Bahadur A, Vimala N, Satyam A, Mittal S: Oxidativestress markers and antioxidant levels in normal pregnancy ... pathways and activation of intrinsic apoptotic mechanisms Mol Endocrinol 2009, 23:1291–1305 110 Harada T, Taniguchi F, Izawa M, Ohama Y, Takenaka Y, Tagashira Y, Ikeda A, Watanabe A, Iwabe T, Terakawa ... Taketani T, Matsuoka A, Yamagata Y, Shimamura K, et al: Oxidativestress impairs oocyte quality and melatonin protects oocytes from free radical damage and improves fertilization rate J Pineal...
... Pgc- 1a GAAAGGGCCAAACAGAGAGA GTAAATCACACGGCGCTCTT Dio2 AAGGCTGCCGAATGTCAACGAATG TGCTGGTTCAGACTCACCTTGGAA Elovl3 GCCTCTCATCCTCTGGTCCT TGCCATAAACTTCCACATCCT b-actin TGTGATGGTGGGAATGGGTCAGAA TGTGGTGCCAGATCTTCTCCATGT ... Hoxc9 GCAGCAAGCACAAAGAGGAGAAG GCGTCTGGTACTTGGTGTAGGG Igfbp3 GCAGCCTAAGCACCTACCTC TCCTCCTCGGACTCACTGAT Dpt CTGCCGCTATAGCAAGAGGT TGGCTTGGGTACTCTGTTGTC Ucp1 GGCCTCTACGACTCAGTCCA TAAGCCGGCTGAGATCTTGT ... animals (rats or mice); and (3) biomedical laboratory for laboratory rodent anesthesia, surgery and necropsy, and sample storage AirCARE is certified by the Association for Assessment and Accreditation...
... 5¢-CCAAGTTGGCAAAGCGCT-3¢ and 5¢-AAAAGAC CAAAGGCCAGCC-3¢ The expression of the target gene was analyzed by western blot analysis using antibodies to CYP2E1 Polyclonal rabbit anti-CYP2E1 was obtained ... oxidative- nitrosative stressand downstream pathways in various forms of cardiomyopathy and heart failure Curr Vasc Pharmacol 3, 221–229 33 Narula J, Pandey P, Arbustini E, Haider N, Narula N, ... 36 Di Napoli P, Taccardi AA, Grilli A, Felaco M, Balbone A, Angelucci D, Gallina S, Calafiore AM, De Caterina R & Barsotti A (2003) Left ventricular wall stress as a direct correlate of cardiomyocyte...
... 20 Oxidativestress induces PARP activation PARP activity in D discoideum was assayed at various time points (5, 10, 20 and 60 and h) after HA stress PARP activity was increased initially, and ... h and then allowing them to develop As can be seen from Table and Fig 3A, development was delayed in a dose-dependent manner at the loose aggregation stage by h and 12 h at LD15 and LD50 of HA, ... starved on nutrient-free agar medium and photographed at 4· magnification (B) Developmental stages of control cells, and 2.5 mM and mM HA-treated cells, at 24 h Scale bar, 10 lm Results are means...
... measurements and gene characterization Recently, evidence of caspase-like involvement in Hydractinia echinata metamorphosis [30] anda caspase gene in the sea anemone Aiptasia pallida [31] has ... potential cleavage sites at aspartate residues 164 and 172 for cleaving the prodomain, anda potential cleavage site at Asp306 for the cleavage between the large and small subunits The prodomain ... in Acasp from the sea anemone A pallida [31] Acasp (large and small subunits) shares an 81% identity and 91% similarity with AvCasp3 but only a 40% identity and 57% similarity with the caspase...
... peri-tubular region for possible tubular repair and regeneration after ADMSC transplantation Changes in mRNA Expression of Vasoactive, Inflammatory, Anti -oxidative, and Apoptotic Mediators in Renal Parenchyma ... inhalational isoflurane and placed in a supine position on a warming pad at 37°C Renal IR was then conducted in group and group animals on which a midline laparotomy was performed Bilateral renal ... al Journal of Translational Medicine 2011, 9:51 http://www.translational-medicine.com/content/9/1/51 Statistical Analysis Quantitative data are expressed as means ± SD Statistical analysis was...
... field campaign, performed the PM measurements and characterization, evaluated and interpreted the data and participated in the writing of the manuscript AS: organized the field campaign, was responsible ... characterization of gaseous pollutants, performed the urinary 8OHdG measurements, evaluated and interpreted the data, prepared and participated in the manuscript writing PW: evaluated the data, ... Bergamini C, Cicoira M, Rossi A, Vassanelli C: Oxidativestressand hyperuricaemia: pathophysiology, clinical relevance and therapeutic implications in chronic heart failure Eur J Heart Failure...
... (forward) and 5’TTGCTGCGTGCTTGATGCTTGT-3’ (reverse); for random mutations: 5’-CCTCAACAGTTAAATCAACAAAACTGC-3’ (forward) and 5’-GCGCTTACTTT GTAGCCTTCA-3’ (reverse) Statistical analysis Data are ... relation between hypoxia, oxidative damage and mitochondrial mutagenesis Materials and methods Patient recruitment All research was carried out in accordance with the Declaration of Helsinki, and ... in oxidativestress is affected Previous studies have demonstrated positive effects of anti-TNF -a treatment on oxidative damage in RA, where urinary levels of oxidative DNA damage andlipid peroxidation...
... domain AMP adenosine monophosphate AMPK AMP-activated protein kinase Apaf-1 apoptosis protease-activating factor-1 ATCC American Type Culture Collection Atg autophagy related ATM ataxia-telangiectasia ... factor-beta-activated kinase 1, TGF-β-activated kinase-1, also known as MAP3K7 or MEKK7), a protein kinase activated by cytokines and upstream of JNK (MAP kinase) and nuclear factor kappa ... mitochondria promotes apoptosis protease-activating factor-1 (Apaf-1) oligomerization and formation of cyt c/Apaf-1/caspase-9 apoptosome (Cain et al., 2000), causing activation of initiator caspase-9 Caspase-9...
... disulfiram Alcohol Alcohol 28, 461–468 30 Isse T, Oyama T, Kitagawa K, Matsuno K, Matsumoto A, Yoshida A, Nakayama K, Nakayama K & Kawamoto T (2002) Diminished alcohol preference in transgenic ... Roman J, Gimenez A, Lluis JM, Gasso M, Rubio M, Caballeria J, Pares A, Rodes J & Fernandez-Checa JC (2000) Enhanced DNA binding and activation of transcription factors NF-kappa B and AP-1 by acetaldehyde ... cellular aldehydes increase during environmental and nutritional exposures, as well as in various diseases with oxidativestress that increases lipidperoxidation Malondialdehyde, 4-HNE and acrolein...
... PFOR has been described for anaerobic bacteria such as Bacteroides [26], D africanus [25,27] and several anaerobic human parasites from the genera Entamoeba [11], Trichomonas [20] and Giardia [21] ... mm acetyl-CoA Basal activity with NADH and the extract was always subtracted Complete inhibition of the ADH activity with pyrazole was determined separately in the ADH assay Acetyl-CoA synthetase ... glycolytic and fermentative enzymes and pathway uxes in live parasites Results Kinetic characterization of EhPFOR in amebal extracts PFORs in several anaerobic parasites have been found attached to plasma...
... dryness and dissolved in 10 lL of ethyl acetate Analysis was performed as above with lg of nonadecanoic acid as internal standard All chemicals were obtained from Sigma-Aldrich, Lyon, France Acknowledgements ... et al Glutathione transferase kappa in C elegans Introduction Glutathione transferase (GST) kappa is a 26.5 kDa protein that was initially isolated from the rat liver mitochondrial matrix and ... °CÆmin)1 and the carrier gas was hydrogen (0.5 bar) The injector and detector were maintained at 225 and 245 °C, respectively Finally, lg of glyceryl triheptadecanoate were used as internal standard...