orthogonal frequency division multiplexing a multi carrier modulation scheme

Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"

Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"

... before-and-after studies [5-9]. A ANZ = Australia and New Zealand; ANZICS = Australian and New Zealand Intensive Care Society; ANZICS-APD = Australian and New Zealand Intensive Care Society Adult ... first year of data as baseline and the second year as comparator. Finally, an additional and similar analysis was performed for hospitals that had partici- pated in the MERIT study. A P value of ... Patient Database; APD = Adult Patient Database; ARCCCR = Australian and New Zealand Intensive Care Society Research Centre for Critical Care Resources; CA = cardiac arrest; ICU = intensive care...

Ngày tải lên: 25/10/2012, 10:35

8 640 0
Multi-Carrier and Spread Spectrum Systems

Multi-Carrier and Spread Spectrum Systems

... 3 Advantages and drawbacks of different multiple access schemes Multiple access scheme Advantages Drawbacks FDMA – Low transmit power – Robust to multipath – Easy frequency planning – Low delay – ... performance. — Accurate frequency and time synchronization is required. 1.2.3 Applications and Standards The key parameters of various multi- carrier- based communications standards for broad- casting, ... flexibility, variable rate transmission and resistance to interference. In Table 3, the main advantages and drawbacks of FDMA, TDMA and CDMA are summarized. From Third- to Fourth-Generation Multiple Access...

Ngày tải lên: 02/03/2013, 16:58

300 422 0
Multi-Carrier Digital Communications - Theory and Applications of OFDM

Multi-Carrier Digital Communications - Theory and Applications of OFDM

... of an equalizer in a typical single carrier implementation for wireline applications. Multi- Carrier Digital Communications Theory and Applications of OFDM Ahmad R. S. Bahai and Burton R. Saltzberg Algorex, ... 1.2, may be thought of as two PAM signals, modulated by carriers at the same frequency but 90 degrees out of phase. At the receiver, demodulation by the same carriers separates the signal components. ... modulation schemes, such as FM, QAM is bandwidth efficient in that it requires the same bandwidth as a PAM signal of the same bit rate. Furthermore, the performance of QAM in noise is comparable...

Ngày tải lên: 02/03/2013, 16:58

221 976 1
Multi-Carrier Technologies for Wireless Communication

Multi-Carrier Technologies for Wireless Communication

... incoming high-rate data stream is mapped to N low rate data streams by a serial to parallel converter; (2) each low rate data stream is modulated onto its own orthogonal carrier, and finally (3) the carriers ... has been a great deal of research and development of late in areas of OFDM (orthogonal frequency division multiplexing) and MC-CDMA (multi- carrier code division multiple access). In addition to ... orthogonal carriers, frequency separated by N orthogonal CI signals can be located at positions Additionally, an extra set of N CI signals can be introduced pseudo- orthogonally at times This was shown...

Ngày tải lên: 02/03/2013, 16:59

215 383 0
Tài liệu Multi-Carrier Cellular at Louisville Baptist Hospital ppt

Tài liệu Multi-Carrier Cellular at Louisville Baptist Hospital ppt

... gave them immediate contact with other doctors and staff,” says Jim Laval, manager of corporate IT at BHSI. Although the doctors carried pagers, there was always a delay of a few minutes between ... looking for a multi- carrier DAS product that BHSI could purchase outright. MULTI- FUNCTION DAS: DREAMS VS. REALITY Laval and his team grew enthusiastic about claims from some vendors about “utility-like” ... everywhere. Since Baptist East was seeking a multi- carrier solution, BHSI staff realized that the Fusion system’s higher integration and use of standard CATV cabling would make it easier to deploy....

Ngày tải lên: 10/12/2013, 19:15

3 203 0
Tài liệu Coarse Wavelength Division Multiplexing (CWDM) docx

Tài liệu Coarse Wavelength Division Multiplexing (CWDM) docx

... used, and 2) multiplexes and demultiplexes the signal across a single fiber link. In many applications, a 1310 nm fiber route has already been established to accommodate existing services. By adding ... (wavelength) at each node along a particular configuration. Each CWDM device is packaged into the VAM platform for seamless integration into fiber panels, distribution frames or cross-connect frame systems, ... Solutions, part of the ADC’s Value-Added Module (VAM) family, add flexibility and functionality to the optical transport system. CWDM modules separate light, or wavelengths, allowing multiple signals...

Ngày tải lên: 21/12/2013, 07:17

4 210 0
Tài liệu ADC Coarse Wavelength Division Multiplexing (CWDM) docx

Tài liệu ADC Coarse Wavelength Division Multiplexing (CWDM) docx

... ExampleA:CatalognumberCWFMT-2LLBE0CY1000wascreatedfrompage23intheVAMcatalog#101663AE: ã Thiscatalognumberexamplewouldhaveacommonportfortheincomingsignalandfourchannels 1530 nm, 1510nm,1490nmand1470nm.Itwouldalsohavea1310upgradeportforlegacy1310nmsystems. Common in in out Example: ... Division Multiplexing CWDM VAM Module Ordering Guide and Information Application #1: Ordering a MicroVAM CWDM Module ã ExampleA:Onecommonportwithfourchannelsanda1310nmupgradeport. ã ExampleA:CatalognumberCWFMT-2LLBE0CY1000wascreatedfrompage23intheVAMcatalog#101663AE: ... GUIDE ADC Coarse Wavelength Division Multiplexing (CWDM) CWDM VAM Module Ordering Guide and Information Page 5 Application #2: Ordering a MicroVAM CWDM Module ã ExampleB:Twocommonportsandtwochannelsforeachcommonport. ã...

Ngày tải lên: 17/01/2014, 11:20

8 247 0
Tài liệu How to build a Multi-Level Money Machine docx

Tài liệu How to build a Multi-Level Money Machine docx

... company has and what a realistic average volume should be. A small distributor who mainly retails may not always break away, yet, breakaway qualifications must be achievable with a fair amount ... factors. As a practical matter, it’s impossible for regulators to predict and legislate all of the infinite variations of legal and illegal marketing programs. For that reason, multi- level and anti-pyramid ... the pay range the top. They look at other plans and realize that with the exact same volume and same organization . . . they would make a lot more money in another company. This creates a leadership...

Ngày tải lên: 24/01/2014, 07:20

196 428 0
Tài liệu Mental Health in a Multi-ethnic Society A Multi-disciplinary Handbook docx

Tài liệu Mental Health in a Multi-ethnic Society A Multi-disciplinary Handbook docx

... important part of the total mental health service. However, the exact balance between hospital care and community care within a mental health service is Fernando—Social realities and mental health ... schizophrenia hinges on the nature of a psychiatric diagnosis and the nature of racial bias. Racial bias is concerned with racist perceptions and beliefs and racist practices incorporated into the diagnostic ... the case of (say) homosexuality, which was a disease until 1973 but not after that (Bayer, 1981), or drapetomania, the disease of black slaves characterised by the symptom of running away from captivity (Cartwright,...

Ngày tải lên: 15/02/2014, 02:20

250 457 0
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf

... PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG Reverse (nt 1585–1552 PAI-2) SJS261 CTTTGTTA AAGCTTATGCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS262 AACTCACCAT AGGAATGCATAAGCTTTAACAAAG Reverse ... GCTCACTGCCTA AGCTTTGTAGCTAATAAAG Forward (nt 1596–1625 PAI-2) SJS175 CTTTATTAGCTACA AAGCTTAGGCAGTGAGC Reverse (nt 1625–1596 PAI-2) SJS259 CTTTGTTATTTATTAT GCATTCCTATGGTGAGTT Forward (nt 1552–1585 PAI-2) SJS260 AACTCACCAT AGGAATGCATAATAAATAACAAAG ... CTTGATTTTGGAGGGATCTC Reverse (nt 318–299 GAPDH) SJS275 TTAGCTACATTAAATAGGCAG Reverse (nt 1620–1601 PAI-2) SJS276 GtaatacgactcactataGGGATCATGCCCATTTAG T7Forward (nt 1491–1508 PAI-2) PAI-2 mRNA decay...

Ngày tải lên: 16/02/2014, 09:20

14 636 0
Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

Tài liệu Báo cáo khóa học: A multi-protein complex containing cold shock domain (Y-box) and polypyrimidine tract binding proteins forms on the vascular endothelial growth factor mRNA Potential role in mRNA stabilization pptx

... of Adelaide, North Terrace, Adelaide, South Australia, Australia Vascular endothelial growth factor (VEGF) is a key regu- lator of angiogenesis and post-transcriptional regulation plays a major ... [34–37] mRNA stabilization. Recent data suggests that PTB proteins may also play a role in this latter type of mRNA stabilization [62]. Factors such as HuR and hnRNPL proteins, have been implicated ... Adamis, A. P. & D’Amore, P .A. (1996) The mouse gene for vascular endothelial growth factor: genomic structure, definition of the transcriptional unit, and characterization of transcriptional...

Ngày tải lên: 19/02/2014, 12:20

13 604 0
On the Segregation of Genetically Modified, Conventional, and Organic Products in European Agriculture: A Multi-market Equilibrium Analysis doc

On the Segregation of Genetically Modified, Conventional, and Organic Products in European Agriculture: A Multi-market Equilibrium Analysis doc

... with the analyses of Lapan and Moschini (2004), Fulton and Giannakas (2004), and Sobolevsky, Moschini, and Lapan (2005). There are at least four reasons for that. First, here we explicitly allow ... orientation, and marital or family status. (Not all prohibited bases apply to all programs.) Persons with disabilities who require alternative means for communication of program information (Braille, ... increases at the demand level (because the effect of segregation costs, which act like a tax, dominates). 24 Table 4. Sensitivity Analysis on Labelling and Traceability Costs Baseline Labelling and traceability...

Ngày tải lên: 05/03/2014, 20:20

36 573 0
w