organizing a collaborative healthcare system in a medical setting

... years of practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on ... involves asking the patient to place his hands behind his back (in Table 2: Differential diagnosis of lumbar spine disorders Lumbar pain Lumbago Sciatica Radicular syndrome disorders affecting spinal ... strain on the bursa subacromialis and so in a typical case of "painful arc" the movement would cause less pain The most reliable test of internal and external rotation is carried out with the arms...

Ngày tải lên: 20/06/2014, 00:20

... Critical Care Vol 13 No Ruskin aerospace medical researchers, and the traveling public Sand and colleagues’ study should serve as a template for future research in this important area Competing interests ... principles and applications in aerospace medicine Aviat Space Environ Med 2007, 78:973-978 Thibeault C, Evans A; Air Transport Medicine Committee, Aerospace Medical Association: Emergency medical kit ... for commercial airlines: an update Aviat Space Environ Med 2007, 78: 1170-1171 European Joint Aviation Authorities: JAR-OPS1, Commercial Air Transportation (Aeroplanes), Global Engineering Documents...

Ngày tải lên: 25/10/2012, 10:06

... arrest) Gastrointestinal complications* Other Sepsis Cardiovascular Gastrointestinal Gastrointestinal bleeding Liver failure/cirrhosis review Acute COPD exacerbation Gastrointestinal commentary Respiratory ... determine the percentage of routine and non-routine radiographs that change management in our medical surgical ICU, and to determine the specific resultant management changes Materials and methods ... changed management In surgical patients with ICU stays shorter than 48 hours, a smaller percentage of routine CXRs (17%) resulted in a change in management In both the medical and surgical patients,...

Ngày tải lên: 25/10/2012, 10:45

... Acta Veterinaria Scandinavica 2009, 51:36 Background Files with information on animal disease have a variety of applications at both the herd and national level, including monitoring the incidence ... scoring a cow and initiating a metritis treatment), would you please elaborate on that specific situation?' Data Analysis The qualitative analysis is based on a phenomenographic approach; that ... provides insight into potential errors (bias and random error) related to data based on clinical examina- Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009,...

Ngày tải lên: 25/10/2012, 10:45

... instructions, as you can see in Table Note that only signed char data use lbs ASSEMBLER write it using a jump Because inserting a jump may make other branches far, we repeat until no far branches remain ... Listing 1—This sample C code declares a binary search tree data structure and defines a binary search function Search returns a pointer to the tree node whose key compares equal to the argument ... enabling a pipelined implementation style; and as each flip-flop has a dedicated clock enable input, it’s easy to stall the pipeline when necessary Long line buses and 3-state drivers form an...

Ngày tải lên: 26/01/2014, 14:20

... of instruction I3 in t3, and so t4 repeats t3 (Repeated pipe stages are italicized.) IL in Listing is a load word instruction Loads and stores need a second memory access, causing pipeline havoc ... by collaboration with an on-chip interrupt controller and the interrupt handler software The last pipeline issue is DMA The PC/address unit doubles as a DMA engine Using a 16 × 16 RAM as a PC register ... registers are enabled by PCE IF branch AN ← PC0 += 2×disp8 BRANCH SELPC PCCE It indicates that all pipe stages are ready and the pipeline can advance IF jal call AN ← PC0 = SUM PCCE PCE is asserted...

Ngày tải lên: 26/01/2014, 14:20

... write address, one half clock to assert / CIRCUIT CELLAR® assert XA14:1, data LSB, XA0=1 assert /WE deassert /WE, hold XA and data assert data MSB, XA1=0 assert /WE deassert /WE, hold XA and data ... make ease-of-use tradeoffs in favor of core users Because FPGAs are malleable and FPGA SoC design is so new, I wanted an interface that can evolve to address new requirements without invalidating ... XD7:0 During a RAM read, XDOUTT is deasserted, RAMNOE is asserted, and the RAM drives its output data onto XD7:0 The data is input through the IBUFs and latched in the XDIN IFDs (on each falling CLK...

Ngày tải lên: 26/01/2014, 14:20

... and Internal Medicine based at Brigham and Women‘s Hospital provides a four-year training program that includes customary internal medicine training, augmented by didactic teaching, longitudinal ... Student Association was initiated in 1997, and the U.S .A chapter of International Federation of Medical Students’ Association (IFMSA) was inaugurated in 1998 Today, many professional specialty organizations ... Competency-Based Global Health Education, and assessment of these goals in Global Health Program Evaluation in Chapter Impact of Global Health Education on Residency Training and Career Path International...

Ngày tải lên: 14/02/2014, 09:20

... CORE SYSTEM Modules Procurement General Ledger Manages storage, access, and reporting of financial data Manages purchases of goods and services Central Data Base Maintains transaction details and ... core system at the Ministry of Finance and spending units in the ministries and agencies At the core are a central database and general ledger, accounts payable, and cash management functions At ... design and implementation effort That goal was an automated, nation-wide financialmanagement information system USAID stated that, in trying to achieve such a system, it operated in “an environment...

Ngày tải lên: 18/02/2014, 04:20

... material poverty, and an inability to acquire the material things necessary to live well Environmental poverty in Asia and the Pacific Poverty in Asia and the Pacific is increasingly concentrated in ... poor living in dryland areas may conclude that the main reasons for their persistent poverty are marginal land and a lack of access to water This does not mean unawareing that the poverty has multiple ... who not live in such marginal areas ADB assumes that in certain rural locations, the primary reason for an inability to escape poverty has to with the natural environment For example, assessments...

Ngày tải lên: 05/03/2014, 16:20

... database systems such as System R [14] use shadow paging strategy to avoid the cost of in- place updates When a transaction updates a data page, it makes a copy, i.e., a shadow, of that page and ... although some cloud storage systems, such as HBase [1] and Cassandra [16], have adopted LSM-trees for maintaining their data, instead of performing in- place updates as in traditional DBMSes, http://sourceforge.net/projects/pbxt/ ... Transaction Manager Data Access Manager Data Access Manager Mem index Mem index Read cache Log … Transaction Manager … Read cache Data Access Manager Mem index Log … … Read cache Log … DFS Client...

Ngày tải lên: 16/03/2014, 16:20

... utilizing Interlingua in mechanical translation as an intermediate language A first step may have to be a more precise determination of what languages could be profitably involved in such a system ... show in this paper that a base text in Interlingua is convertible by mechanical means into an editable translation in a target language belonging to the group of languages which are summarized in ... allusion and define the task of the researcher in mechanical translation as amounting to the elabo- Signal System in Interlingua ration of a system whereby all the elements appearing in the finished...

Ngày tải lên: 16/03/2014, 19:20

... classical ATP formation pathways and the AMP–AMP phosphotransferase network The latter reaction may represent a compensatory mechanism for maintaining and increasing ADP to the levels necessary ... revealed the disappearance of ADP and the formation of an ATP peak, which was identified in the chromatogram using the same criteria as for ADP and inosine Enzyme assays and identification of reaction ... interfering contaminants The non-retained fraction contained MK and AdK activities ADA was eluted using a linear gradient with the same buffer spiked with m NaCl in five column volumes MK, AdK, ADA and...

Ngày tải lên: 23/03/2014, 06:20

... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... of amplified message DNA ladder is marked M (A) HaCaT keratinocytes (lane 1); normal epidermal keratinocytes (lane 2); C1–4 squamous cell carcinoma (lane 3); dermal fibroblasts (lane 4); epidermal ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane...

Ngày tải lên: 23/03/2014, 13:20

... 5¢-GGGGACAAGTTTGTACAAA AAAGCAGGCTTAGAGTTTGCACTCTATACG-3¢ and attB2_ASP ⁄ Crypto_dom 5¢-GGGGACCACTTTGTACAA GAAAGCTGGGTACTATTGCCTGATTTGACGTAT-3¢ at an initial denaturation at 95 °C for min, followed ... 1266–1245) and the TubB-Probe FAM-5¢-TGTTGGCAACAGCACTGCC ATCCAAGAG-3¢-TAMRA (nucleotides 1177–1204) were used The product size was 141 bp For GAPDH, FAM5¢-CAAGAAGGCTTCAGAAGACCAGACATTGAAGA AC-3¢-TAMRA ... l-arabinose as the transcription-inducing agent The bacterial crude extract was prepared and analyzed by SDS ⁄ PAGE (Fig 4A) In l-arabinose-induced samples (Fig 4A, lane a) , as well as in noninduced...

Ngày tải lên: 29/03/2014, 08:20

... they are invariably attached to the savings bank in the region in which they operate In this way, several savings companies are attached to each savings bank, but with varying numbers in each case ... since 1999 These are not involved in the financial business but are closely associated with the savings banks in a legal and practical sense The local savings companies The local savings companies ... they may acquire shares in the savings companies, which in turn use all the funds obtained in this way to obtain shares in the savings banks As a result, the importance of a savings companies...

Ngày tải lên: 29/03/2014, 08:20

... Taiwan, August 31st — September 1st Marius Pasca and Sanda Harabagiu 2001 High performance question/answering In Proceedings of the 24th Annual International ACL SIGIR Conference on Research and ... LOCATION CE BUILDING X? Ce caste] este faimos in Romania? Which castle is famous in Romania? LOCATION CAND X? Cand a fost adoptata Constitutia? Constitution adopted? When was the DATE Table 1: Some ... on the basis of the words contained in them Pasca and Harabagiu (2001) show that such an approach has significant influence on the overall performance of the QA systems The answer extraction module...

Ngày tải lên: 31/03/2014, 20:20

... Training Information Monitoring System (TIMS©), which stores key participant and training information for all PEPFAR-funded training events This paper describes a project that uses training data ... that follow-up data could be collected on an individual basis at each facility In some cases, training information was not yet entered into TIMS, and the partners collected all training information ... Working status was analysed based on work location by grouping regions into established regions (Addis Ababa; Amhara; Dire Dawa; Harari; Oromia; Southern Nations, Nationalities and Peoples States...

Ngày tải lên: 18/06/2014, 17:20

... Research Ethics Boards The Ministry of Health in Canada approved the system as a new class II medical device in Canada for investigational trials If the individuals met the inclusion criteria and ... preferred a familiar Canadian measure, the CMSA This impairment measure divides arm and hand recovery into separate motor stages (1-7), allowing patients to be placed in similar bins as well as allowing ... Erlandson RF: Application of robotic/mechatronic systems in special education, rehabilitation therapy, and vocational training: A paradigm shift” IEEE Transactions on Rehabilitation Engineering...

Ngày tải lên: 19/06/2014, 08:20

... the data element in question was resolved by the majority opinion of this panel Data were entered by a research technician into a Microsoft Access database Data analysis Data were analyzed using ... a more organized and programmatic approach to research in the area of technology-assisted education (and medical education in general) to advance our understanding in this domain [36-39] Detailed ... Services librarian using the MeSH terms ("Education, Medical OR “Education, Medical, Undergraduate” OR “Education, Medical, Graduate” OR “Education, Medical, Continuing”) AND “ComputerAssisted Instruction.”...

Ngày tải lên: 21/06/2014, 01:20