order of procedure steps 1 and 2
Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in fibrinolysis and plasmin-induced cell detachment and apoptosis docx
... respectively, cells and fibrin: A10 .2 ¼ 9 .2 nM and nM; 34D3 ¼ 13 .1 nM and nM; mAb mix ¼ 11 .8 nM and nM K4-LBS is permanently exposed, supports this hypothesis Blockage by mAb A10 .2 of K4-LBS exposed ... fibrin and fibrinogen J Biol Chem 25 8, 424 9– 425 6 22 Knudsen BS, Silverstein RL, Leung LL, Harpel PC & Nachman RL (19 86) Binding of plasminogen to extracellular matrix J Biol Chem 2 61, 10 765 10 7 71 23 ... Chem 25 7, 21 0 4– 21 1 0 41 Markus G, DePasquale JL & Wissler FC (19 78) Quantitative determination of the binding of epsilon-aminocaproic acid to native plasminogen J Biol Chem 25 3, 727 –7 32 42 Markus...
- 14
- 558
- 0
Tài liệu Báo cáo Y học: Binding of gelsolin domain 2 to actin An actin interface distinct from that of gelsolin domain 1 and from ADF/cofilin pptx
... and mixed with 11 2 12 5 and 11 9– 13 2 actin peptides As shown in Fig 8B, the 11 9 13 2 peptide does not perturb FITC In contrast the 11 2 12 5 peptide induces a fluorescence decrease of the label, but ... sequences Peptide 15 9 19 3 Kd ELISA Peptide 15 9 19 3 Kd fluorescence Cofilin Kd Reference for cofilin Actin G Actin F 1 10 18 28 84 10 3 11 2 12 5 11 9 13 2 347–365 338–348 360–3 72 355–375 1. 3 mM ND No binding ... Two peptides belonging both to the 11 4 22 5 sequence and exposed regions of subdomain were tested (11 2 – 12 5 and 11 9 – 13 2 peptides) Interaction of the 15 9 19 3 fragment with the coated peptides...
- 11
- 460
- 0
Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx
... penneri strain 40 41 25 600 < 10 0 < 10 0 320 0 320 0 25 600 < 10 0 < 10 0 320 0 320 0 12 800 < 10 0 < 10 0 < 10 0 < 10 0 12 800 < 10 0 < 10 0 < 10 0 < 10 0 6400 < 10 0 < 10 0 5 12 00 6400 < 10 0 < 10 0 NT NT < 10 0 NT NT O-antiserum ... b-D-GalpNAcII- (1 ® a-D-GlcpII- (1 ® C1 C2 C3 C4 C5 C6 10 5.6 10 2. 6 99.7 74.3 52. 5 68.8 76.9 81. 6 81. 3 70.4 69 .2 77 .1 75.4 75.7 71. 5 66.8 61. 9 62. 2 10 5 .1 54 .1 72. 5 69 .1 76 .2 62. 5 10 5.6 10 2. 6 99.8 74.3 52. 4 ... 25 600 25 600 12 800 12 800 31. 7 15 .8 25 0.0 25 0.0 0.5 0.5 7.8 7.8 25 6000 10 24 000 10 00 10 00 6400 5 12 00 10 0 10 0 12 5.0 7.9 > 10 00 > 10 00 > 10 00 > 10 00 Table Passive immunohemolysis of the alkali-treated...
- 6
- 560
- 0
Báo cáo khoa học: Inhibitors of protein phosphatase 1 and 2A decrease the level of tubulin carboxypeptidase activity associated with microtubules pptx
... Sugimura, T (19 90) 24 25 26 27 28 29 30 Calyculin A, an inhibitor of protein phosphatases, a potent tumor promoter on CD -1 mouse skin Cancer Res 50, 35 21 3 525 Li, Y.-M & Casida, J.E (19 92) Cantharidin-binding ... inhibitors of PP1 and PP2A [23 ,24 ], showed effects similar to that of OA (Fig 4) Deltamethrin, a specific inhibitor of PP2B [25 ], and phenylarsine oxide, a putative inhibitor of tyrosine phosphatases [26 ], ... IMAGING SYSTEM and, for each condition, the ratio Glu/Tyr was calculated A/B ¼ 0 .17 ± 0.03; C/D ¼ 1. 21 ± 0 .15 ; E/F ¼ 0 .28 ± 0.04; G/H ¼ 1. 12 ± 0 .17 Each value represents the mean ± SE of four independent...
- 9
- 301
- 0
báo cáo hóa học:" Gene and microRNA analysis of neutrophils from patients with polycythemia vera and essential thrombocytosis: down-regulation of micro RNA-1 and -133a" pot
... 27 .8 1, 1 81 ± 10 91 8,4 21 ± 2, 684 930, 916 ± 650,0 21 527 ,593 ± 45 ,14 17 338 ± 330 10 9.0 ± 52. 9 1, 9 62 ± 1, 665 39.4 ± 32 .1 0. 0 12 3 0. 014 5 0. 018 5 0. 019 0 0. 022 0 0. 020 9 0. 024 9 0. 026 3 0.03 52 0.03 81 0.04 21 ... hsa-miR -19 a hsa-miR -20 0b hsa-miR-5 42- 3p hsa-mir- 625 hsa-miR -10 6b hsa-miR -20 b 4 .11 2. 63 2. 47 2. 43 2. 21 1.93 1. 92 1. 86 1. 86 1. 81 1.76 1. 73 1. 70 1. 66 1. 63 1. 6 1. 48 1. 43 1. 42 1. 33 1. 31 hsa-miR -13 3a hsa-miR-504 ... P 1, 707, 21 1 ± 5,080 716 ± 19 5 62. 6 ± 9.9 54 .1 ± 63 .1 5, 21 5 ± 1, 606 28 7,485 ± 89,954 13 1,558 ± 35 ,29 8 21 . 0 ± 13 .0 61. 1 ± 7.5 473 .1 ± 23 9 11 .1 ± 6.5 10 ,467, 524 ± 7,793,493 1, 6 72 ± 854 93.5 ± 27 .8...
- 17
- 524
- 0
Báo cáo toán học: "Graphs Associated with Codes of Covering Radius 1 and Minimum Distance 2" ppsx
... electronic journal of combinatorics 15 (20 08), #R68 3 X X X 0 Figure 5: The partial Latin square equivalent {000, 011 , 022 , 10 1, 11 0, 13 3, 20 2, 21 3 , 2 21 , 23 0, 303, 320 , 3 32} to the code Figure ... permutation R ( 12 ) C ( 12 ) S ( 12 ) squares with row of 032X and 023 X are equivalent to squares with row of 013 X and 031X Thus only squares with row of 0 12 X, 021 X, 013 X, or 031X are considered (figure 16 ) • ... 1, 2) = 16 We completely catalogue (3, V, 2) 4 codes where V = 8, 9, 10 , 11 , 13 , 14 , 15 , 16 and provide some examples for V = 12 Theorem 12 [6, Thm 3 .14 ] There is a unique (3, 8, 2) 4 code Proof...
- 17
- 252
- 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
... et al Journal of Experimental & Clinical Cancer Research 2 011 , 30 :16 http://www.jeccr.com/content/30 /1/ 16 Received: 30 September 2 010 Accepted: February 2 011 Published: February 2 011 References ... (Table 2) Restage before RIT: CT, PET, BMB Zevalin® FCR -28 CYCLES 11 .1- 14.8 MBq/Kg CR/CRu or PR F: 25 mg/m2 i.v days 1- 3 C: 1gr/m2 i.v day R: 375mg/m2 i.v day Figure Treatment schema Restage 12 weeks ... cycles of FCR: fludarabine at a dose of 25 mg/m2 i.v on days to 3; cyclophosphamide at a dose of gr/m2 i.v on day and rituximab Page of at a dose of 375 mg/m2 was given on day of each cycle every 28 ...
- 5
- 287
- 0
Báo cáo y học: " Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus" pps
... http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Analysis of recombinant AmCPV S1 and S3 encoded proteins expressed in E coli and insect cells AmCPV S1 and S3 were expressed in E coli M15 cells as insoluble 14 1 kDa (Fig 2A, ... pH-7.3 (B), and at pH - 12 (C) and analyzed by TEM at 50 kV Bar 10 0 nm Chakrabarti et al Virology Journal 2 010 , 7 :18 1 http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Table Stability of native ... Chakrabarti et al Virology Journal 2 010 , 7 :18 1 http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Figure Immunoblot analysis of recombinant VLPs using anti-p137 and anti-p1 41 antibodies (A) SDS-8% PAGE,...
- 11
- 307
- 0
Báo cáo y học: "Transcriptional regulation of matrix metalloproteinase-1 and collagen 1A2 explains the anti-fibrotic effect exerted by proteasome inhibition in human dermal fibroblasts" docx
... 4, 12 11 Geneva 14 , Switzerland and 2Department of Pathology and Immunology, Geneva University Hospital and School of Medicine, rue Michel Servet 1, 12 11 Geneva 14 , Switzerland 19 Received: 10 ... transfection and reporter gene assays COL1A1 Hs0 016 4099_m1 TIMP -1 Hs0 017 1558_m1 MMP -1 Hs0 023 3958_m1 MMP -2 Hs0 023 4 422 _m1 HsEEF1A1 CACCTGAGCAGTGAAGCCAGCTGCTT DNA pull-down assay Biotin-MMP -1- S GATCGAGAGGATGTTATAAAGCATG ... 19 Received: 10 December 20 09 Revised: April 2 010 Accepted: 29 April 2 010 Published: 29 April 2 010 21 20 ArthritisGoffin et al.;Therapy 2 010 , 12 :R73 under the terms of the Creative Commons Attribution...
- 14
- 286
- 0
The roles of histone deacetylases 1 and 2 in hepatocellular carcinoma
... 17 1. 9 Cooperative and distinct functions of HDAC1 and 18 1. 9 .1 Redundancy of HDAC1 and HDAC2 functions 18 1. 9 .2 Distinct functions of HDAC1 and HDAC2 19 1. 10 Inhibition of ... 20 1. 11 Biological effects and mechanisms of action of HDAC inhibitors 20 1. 11. 1 Apoptosis 20 1. 11. 2 Growth arrest 22 1. 11. 3 Mitotic disruption and autophagy ... 23 1. 11. 4 Anti-angiogenesis, anti-metastasis and invasion 24 1. 11. 5 Anti-tumor immunity 25 1. 12 HDAC inhibitors in cancer therapy 26 1. 12 .1 Clinical trials 26 ...
- 168
- 372
- 0
Cambridge.University.Press.The.Works.of.Archimedes.Volume.1.The.Two.Books.On.the.Sphere.and.the.Cylinder.Translation.and.Commentary.May.2004.pdf
... dependencies of chapters and 6.) 34 32 Chapter 33 31 30 29 27 28 26 25 24 23 21 Interlude: Ch 4: Ch 3: 18 19 20 14 13 23 Ch 1: 44 43 41 42 40 38 39 36 37 35 Ch 5: Interlude: Ch 4: Ch 3: Ch 1: 33 23 22 18 ... First published in print format 20 04 isbn -13 isbn -10 978-0- 511 -19 430-6 eBook (EBL) 0- 511 -19 430-7 eBook (EBL) isbn -13 isbn -10 978-0-5 21 - 6 616 0-7 hardback 0-5 21 - 6 616 0-9 hardback Cambridge University ... inequalities 14 Tusculan Disputations, V .23 19 20 i n t ro d uc t i on Chapter Propositions 7 12 , measuring the surfaces of various pyramidical figures Chapter Propositions 13 16 , measuring and finding...
- 387
- 1,245
- 3
Báo cáo y học: "Grb2-associated binder 1 polymorphism was associated with the risk of Helicobactor pylori infection and gastric atrophy"
... (54.8) 1. 00 (Reference) 1. 87 (1. 06-3 .29 ) 4 .24 (0.45-39.7) 1. 95 (1. 12- 3.40) 49 23 12 1 55 24 8 20 (40.8) 12 ( 52. 2) 64 ( 52. 9) 39 (70.9) 13 5 (54.4) 1. 00 (Reference) 1. 57 (0.58-4 .29 ) 1. 60 (0. 82- 3 .15 ) ... PTPN1 1and the Gab1 was not observed (OR =1. 39, 95% CI 0. 41- 4.66) 20 4 (44.9) 25 0 (55 .1) 23 (11 .4) 17 9 (88.6) Table Genotype frequency and odds ratios (ORs) and 95% confidence intervals (95%CIs) of ... 1. 00 (Reference) 1. 30 (0. 81- 2. 07) 0 .25 (0.08-0. 71) 1. 02 (0.67 -1. 56) odds ratio Table ORs and 95% CIs for gastric atrophy (GA) of Gab1 and the combinations of PTPN 11 and Gab1 genotypes among seropositive...
- 6
- 541
- 0
Báo cáo y học: "Characterization of N200 and P300: Selected Studies of the Event-Related Potential Salil H. Patel 1 and Pierre N. Azzam 2"
... via studies of the MMN [10 3] 15 2 10 11 12 13 14 15 16 17 18 Closing Remarks Each of the specific components of the Event-Related Potential discussed in this review plays specific and significant ... conflict of interest exists 19 20 21 22 23 24 References Sabatini RME Mapping the brain Brain and Mind Magazine 19 97; Pritchard WS Psychophysiology of P300 Psychological Bulletin 19 81; 89:506-540 ... Physiology and Behavior 19 94; 56: 511 - 516 66 Tarkka IM, Stokic DS Source localization of P300 from oddball, single stimulus, and omitted-stimulus paradigms Brain Topography 19 98; 11 :14 1 -15 1 67 Polich...
- 8
- 563
- 0
WCDMA UTRAN Interface and Signaling Procedure ISSUE 1.1
... Q.AAL2 Est Req Q.AAL2 Q.AAL2 Est Conf Q.AAL2 NBAP NCP: Comm TrCh Setup Req NBAP NBAP NCP: Comm TrCh Setup Rsp NBAP Q.AAL2 Est Req Q.AAL2 Q.AAL2 Est Conf Q.AAL2 Contents UTRAN Signaling Procedure ... User Plane Q .26 30 .1 SCCP MTP3b Q. 21 5 0 .1 MTP3b SSCF-NNI SSCF-NNI SSCOP SSCOP AAL5 AAL5 AAL2 ATM Physical Layer Copyright © 20 08 Huawei Technologies Co., Ltd All rights reserved Page14 Iu-PS Interface ... Physical Layer Copyright © 20 08 Huawei Technologies Co., Ltd All rights reserved Physical Layer Page15 Iub Interface Radio Network Control Plane User Plane Q .26 30 .1 Q. 21 5 0 .2 Transport Layer SSCF-UNI...
- 84
- 317
- 0
Root Finding and Nonlinear Sets of Equations part 1
... char scr[ISCR +1] [JSCR +1] ; for (;;) { printf("\nEnter x1 x2 (x1=x2 to stop):\n"); Query for another plot, quit scanf("%f %f",&x1,&x2); if x1=x2 if (x1 == x2) break; for (j =1; j
- 4
- 352
- 0
Tài liệu Understanding and Using Letters of Credit Part 1 pptx
... Invoice The billing for the goods and services It includes a description of merchandise, price, FOB origin, and name and address of buyer and seller The buyer and seller information must correspond ... performance of conditions of the credit Sight and Time Drafts All letters of credit require the beneficiary to present a draft and specified documents in order to receive payment A draft is a written order ... accept drafts and pay them at maturity Standby Letter of Credit The standby letter of credit serves a different function than the commercial letter of credit The commercial letter of credit is...
- 9
- 511
- 0
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... SC, Grierson FEBS Journal 27 8 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS C Forzani et al 10 11 12 13 14 15 16 17 18 CS, Hirt H et al (20 04) OXI1 kinase is necessary for ... cold and salt stress signaling in Arabidopsis Mol Cell 15 , 14 1 15 2 FEBS Journal 27 8 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 11 35 PTI1-4, a common target of OXI1 and ... Three of the prey cDNAs encoded two other FEBS Journal 27 8 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 11 27 pBD-OXI1 pBD-OXI1 pBD pBD-OXI1 pBD-PTI1-4 pBD pBD-PTI1-4 C...
- 11
- 700
- 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx
... Neutral Alkaline -1 Alkaline -2 2.63 2. 21 1. 82 2.86 2. 29 1. 59 2. 78 2 .14 1. 74 2. 68 2. 20 1. 80 27 7.6 2. 09 2. 01 1.96 31 7 .1 2. 08 2. 00 1. 96 Alkaline 2. 67 2. 21 1.79 26 7.5 2. 08 2. 01 1.97 at the lower magnetic ... Visible 405 12 7 428 415 420 414 8 .2 500, 630 4 02 12 8 557 427 5 41, 578 410 539, 569 427 539, 577 427 8.9 498, 6 31 404 14 0 555 4 31 537, 574 410 536, 566 419 537, 575 414 7.6 500, 6 31 554 540, 575 ... heme oxygenase -1 10 11 12 13 14 15 16 17 18 19 20 21 22 T Gohya et al ferredoxin-dependent heme oxygenase required for phytochrome chromophore synthesis Plant Physiol 14 0, 19 58 19 66 Emborg TJ,...
- 16
- 617
- 0
Tài liệu Báo cáo khoa học: Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12-myristate 13-acetate pptx
... Chem 26 6, 11 62 11 69 54 Brondello, J.M., Pouyssegur, J & McKenzie, F.R (19 99) Reduced MAP kinase phosphatase -1 degradation after p 42/ p44MAPK-dependent phosphorylation Science 28 6, 2 514 2 517 55 ... Ther 88, 22 9 27 9 15 Treisman, R (19 96) Regulation of transcription by MAP kinase cascades Curr Opin Cell Biol 8, 20 5– 21 5 16 Cook, S.J., Aziz, N & McMahon, M (19 99) The repertoire of fos and jun ... Biol Chem 27 4, 3 016 9–3 018 1 3 9 12 J J Hornberg et al (Eur J Biochem 2 71) Bhalla, U.S & Iyengar, R (19 99) Emergent properties of networks of biological signalling pathways Science 28 3, 3 81 387 Lauffenburger,...
- 9
- 541
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008