orbit spectrum resource a valuable example for the extraterrestrial resources regime
Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A valuable tool for establishing a pan-European dataset" docx
... combination of such databases, the management of missing data and the sensible exploration of large-scale data For now, both approaches are valid A robust, clearly defined core dataset common to all ... product administration can all be tagged electronically, as can the patient's position within the hospital Other databases, such as ICU, pathology and radiology systems already collect much of the ... equipment and infrastructure Prehospital data can be downloaded wirelessly from a paramedic's PDA as soon as they come within wireless range of the admitting hospital Physiological data, drug and blood...
- 2
- 246
- 0
A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son
... involves the transmission of payment transaction data, and associated remittance advice data, from a payee to their bank, for onforwarding (via banks and/or value-added network operators) to the payee's ... interface for service suppliers to update their own database So, there is no immediate link from the application’s database and the database of the suppliers 1.7 Organization of the research • ... payment card vouchers These mechanisms have various characteristics, such as the extent to which the parties are identified, the traceability of the transaction, and the taxability of the transaction...
- 58
- 472
- 0
Tài liệu Machinery''''s Handbook 27th Edition A REFERENCE BOOK FOR THE MECHANICAL ENGINEER, docx
... a = aa = a a = ⎛ a ⎝ b⎠ b3 a × a × a = aaa = a a × b = ab a b = ( ab ) = ⎛ 1⎞ = a – -⎝ a a3 a2 a3 = a2 + = a5 ( a2 )3 = a2 × = ( a3 )2 = a6 a4 ÷ a3 = a4 – = a a + b = ( a + b ) ( a – ab ... Addition:When adding two complex numbers, the real parts and imaginary parts are added separately, the real parts added to real parts and the imaginary to imaginary parts Thus, Copyright 2004, Industrial ... a0 = a – b = ( a – b ) ( a + ab + b ) a2 – b2 = ( a + b ) ( a – b ) ( a + b ) = a + 3a b + 3ab + b a a 3 3 3 a – b = ( a – b ) + 3ab ( a – b ) a a = a 2 a + b = ( a + b ) – 3ab ( a + b ) a b...
- 3,340
- 636
- 2
Tài liệu VIRTUAL REALITY - A NEW TECHNOLOGY FOR THE MECHANICAL ENGINEER docx
... platform This also has an important practical advantage in that a much Fig 14.2 VR system architecture wider (and cheaper) range of devices is available for a PC or Macintosh than for its workstation ... the need for realism, it is imperative to maintain a reasonable performance for the VR application Here "performance" refers to the response of the virtual environment to the user's actions For ... computational workload on the main processor, another benefit of running the input component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform...
- 10
- 634
- 1
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... national, regional or local level, and to cooperate with similar fora at national level At the same time, the Platform can create input for integrating the responses to the obesity challenge into a ... epidemic calls for multi-stakeholder approaches5 - for which the European Platform for Action on Diet, Physical Activity and Health (cf section IV.1) is a prominent example - and for action at local,...
- 22
- 703
- 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... A , which has the great advantage that the path of ρ does not depend on the paths of the other particles This is the reason why the case DA = DB is special We proved in [KSb] that on a certain ... same distribution at the space-time point (x + y, t + s) as the full-space process (started at (0, 0)) at the point (y, s) Again we shall use the same random walk paths A for all the full-state ... constant whose value remains the same throughout this paper (a. s is an abbreviation of almost surely) Acknowledgement The research for this paper was started during a stay by H Kesten at the Mittag-Leffler...
- 67
- 490
- 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... one species from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different ... such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as the bacteria are plant-cells, they must imbibe[Pg 6] their ... differentiated, and that is, that practically all of them are capable of producing their characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere...
- 201
- 540
- 0
Tài liệu The Pathways Commission Charting a National Strategy for the Next Generation of Accountants pptx
... of national data on current employment and the ability to link these data to higher-education databases makes it easier to gather this data today To further leverage these advances, a mechanism ... business and economic activity and the very lifeblood of global capital markets The term “accounting information” encompasses financial and nonfinancial information about the activities, performance, and ... difficult to obtain Recent advances in the coverage and accessibility of national data on employment and the ability to link these data to higher-education databases are starting to alleviate this condition...
- 140
- 391
- 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management.") ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic reality created by targets and environments...
- 14
- 780
- 0
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... catalytic domains; black dots, protease cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system ... semipermeabilize cells for intracellular staining, cells were incubated in 4% paraformaldehyde for 30 at °C in the first instance and then stained as described above Confocal microscopy and imaging...
- 14
- 669
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... compared to h: *P < 0.05; **P < 0.01 sion number AAG09721) are located adjacently in a head-to-head orientation, and their transcription start sites are 1.5 kb apart We therefore analyzed the ... Kitamuro T, Takahashi K, Ogawa K, Udono-Fujimori R, Takeda K, Furuyama K, Nakayama M, Sun J, Fujita H, Hida W et al (2003) Bach1 functions as a hypoxia-inducible repressor for the heme oxygenase-1 gene ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...
- 12
- 621
- 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt
... equal, canceling the negative subgraph with a positive graph of the same absolute value (see below for an example) Therefore, only damped oscillations can be obtained in such a case Additional ... necessary for the negative graph to induce sustained oscillations We shall analyze the steady states, because the presence of steady states on the phase-space border and the irreversible steady-state ... oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest and the parameters k6 and k7 are the smallest in the system Oscillations in this system can...
- 11
- 638
- 0
140 CHARACTERS A Style Guide for the Short Form
... Minimize adverbs and articles Commas are a favor to the reader, not always necessary Eliminate personal pronouns When all else fails, invent a tag .A great tag works as the target of a search, and also ... communication is ubiquitous and instantaneous Those same features are also the bane of the medium Interruption and distraction can appear at any time, and anywhere The weakness of short-form communication ... social change Today, a transformation is happening Short messaging services, and the rich media applications that magnify them, are augmenting society one layer at a time Superfluous, outmoded forms...
- 210
- 3,112
- 0
Time Banks A radical manifesto for the UK ppt
... Time Banks UK and their partners at the TimeBank campaign, and the idea has been hailed as a vital tool for rebuilding trust and social capital Community time banks are widely regarded as a neat ... trust and social capital when it has all but gone But they are still culpable It is their fault that they have clung too long to an old-fashioned idea of professionalism, and a dream that they ... depression – because they find that taking part in the time bank can mean real improvements The South London and Maudsley NHS Trust covers the same area specialising in mental health, and have watched...
- 18
- 317
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... stress, a loss of regulation of Ab production, and an increase in tau hyperphosphorylation Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid ... the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent in the disease The 39–43 amino acid cleavage product of the Ab A4 precursor protein (APP)...
- 9
- 634
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox ... acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower ... l-gulono-1,4-lactone [17] as substrates d-Arabinono-1,4-lactone is a natural substrate in the pathway to d-erythroascorbic acid [14,18] Like yeasts, a protozoan parasite Trypanosoma brucei possesses a d-arabinono-1,4-lactone...
- 11
- 571
- 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc
... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... area where bank …nancing is the predominant means of …nancing for non-…nancial corporations For example, by the end of 2007 bank loans to the private sector In the euro area banking sector balance ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3,...
- 30
- 911
- 0
Báo cáo khoa học: "A Formula Finder for the Automatic Synthesis of Translation Algorithms" docx
... in the formula; the machine will use only those variables that are actually required A THE AUTOMATIC SPECIFICATION OF VARIABLES AND EVALUATION OF FORMULAS Variables in the determiner formula and ... specification of variables, and the automatic evaluation of formulas The proposed formula finder and trial translator systems are compatible; the former enables the semiautomatic derivation of basic ... elementary transformations having the Wij as their arguments; they are called basic algorithms A THE LOGICAL STRUCTURE OF BASIC ALGORITHMS The basic algorithms to be derived by the formula finder are...
- 14
- 432
- 0
Effects-Based Operations A Grand Challenge for the Analytical Community pot
... instances of causing a favorable decision by national leaders was the American use of atomic bombs against Japan Proponents of EBO are well aware that past wars have typically emphasized death and ... airfields contain or destroy air force and surface-to-air missiles (SAMs) remained; Iraqi air force did not engage and eventually fled to Iran Naval Attain sea control All Iraqi combatants neutralized, ... military affairs (RMA) and military transformation have put a premium on rethinking the art and science of war Human war games are useful but nowhere near sufficient There is a critical need for...
- 117
- 299
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008