optional a tour of the discovering design patterns
How to program java doc
... Java programmers take advantage of rich collections of existing classes in Java class libraries The class libraries are also known as the Java APIs (Application Programming Interfaces) Thus, there ... Client and Supporting Classes 17.11 (Optional) Discovering Design Patterns: Design Patterns Used in Packages java.io and java.net 17.11.1 Creational Design Patterns 17.11.2 Structural Design Patterns ... and maintainable object-oriented software.1 Using design patterns can substantially reduce the complexity of the design process We present several design patterns in Java, but these design patterns...
Ngày tải lên: 22/03/2014, 18:20
java how to program, 4th 2004
... Java programmers take advantage of rich collections of existing classes in Java class libraries The class libraries are also known as the Java APIs (Application Programming Interfaces) Thus, there ... Client and Supporting Classes 17.11 (Optional) Discovering Design Patterns: Design Patterns Used in Packages java.io and java.net 17.11.1 Creational Design Patterns 17.11.2 Structural Design Patterns ... and maintainable object-oriented software.1 Using design patterns can substantially reduce the complexity of the design process We present several design patterns in Java, but these design patterns...
Ngày tải lên: 19/04/2014, 21:06
Strings and Vectors
... C-strings as Arguments and Parameters C-string variables are arrays C-string arguments and parameters are used just like arrays If a function changes the value of a C-string parameter, it ... include a parameter for the declared size of the C-string If a function does not change the value of a C-string parameter, the null character can detect the end of the string and no size argument ... Publishing as Pearson Addison-Wesley Slide 8- 18 The strncat Function strncat is a safer version of strcat A third parameter specifies a limit for the number of characters to concatenate Example:...
Ngày tải lên: 12/09/2012, 22:51
Strings and Pattern Matching Pattern Matching
... trò băm ng Dương Anh Đức – Nhập môn Cấu trúc Dữ liệu Giải thuật 12 Thuật toán Rabin-Karp ̈ Hãy xem ví dụ để rõ chút: ̊ Giá trò băm “AAAAA” 100 ̊ Giá trò băm “AAAAH” 37 Dương Anh Đức – Nhập môn ... ̊ ab + c ký hiệu tập hợp {ab, c} ̊ a* ký hiệu tập hợp a, aa, aaa, Dương Anh Đức – Nhập môn Cấu trúc Dữ liệu Giải thuật 31 Regular Expressions ̈ Ví du ̊ (a+ b)* tất các chuỗi ký tự với chữ {a, b} ... ký tự với chữ {a, b} ̊ b*(ab *a) *b* chuỗi ký tự với số chẵn ký tự a ̊ (a+ b)*sun (a+ b)* chuỗi ký tự có ch a chuỗi “sun” ̊ (a+ b) (a+ b) (a+ b )a chuỗi ký tự kết thúc a ng Dương Anh Đức – Nhập môn Cấu trúc...
Ngày tải lên: 18/09/2013, 21:53
Figure Drawing - Beer and Deer
... Tensor fasciae latae; TibCr Tibialis cranialis; Trap Trapezius; TriLa Triceps brachii, lateral head; TriLo Triceps brachii, long head; UlLat Ulnaris lateralis; VasLa l/fosfus lateralis; Zyg Zygomaticus ... cranialis; Trach Trachea; Trap Trapezius; TriLa Triceps brachii, lateral head; TriLo Triceps brachii, long head; UlLat Ulnaris lateralis; VasLa Vastus lateralis; Zyg Zygomaticus (after blainvilee;skull ... brachiocephalicus and omotransversarius muscles, which usually cover the neck, begin low on the side of the neck, rather than up at the skull and first neck vertebra Back line slopes downward toward rear...
Ngày tải lên: 07/11/2013, 11:15
Tài liệu Figure Drawing - Feline and Domestic Cat ppt
... Iliocostalis; Trach Trachea; Trap Trapezius; TriAc Triceps brachii, accessory head; TriLa Triceps InAbO Internal abdominal oblique; Infra Infraspinatus; Inter Interossei; LatDo brachii, lateral head; ... Inter Interossei; LAOM Levator anguli oculi medialis; LatDo Latissimus dorsi; LeNas Levator nasolabiatis; LLaMx Levator labii maxillaris; Long! Longissimus; Malar Malaris; Mass Masseter; Myloh Mylohyoid; ... MetcS F//W7 al head; TrnAb Transversus abdominis; Uln t///7O; Vasln Vasfus intermedius; VasLa metacarpal; MettZ Second metatarsal; MettS F7/W? metatarsal; Mult Multifidus; ZygAr Zygomatic arch Myloh...
Ngày tải lên: 14/12/2013, 15:16
Tài liệu Module 4 Arrays, Strings, and Pointers pptx
... its argument is a letter of the alphabet CRITICAL SKILL 4.6: Array Initialization C++ allows arrays to be initialized The general form of array initialization is similar to that of other variables, ... an array to hold the values Arrays are fundamental to modern programming The general form of a one-dimensional array declaration is type name[size]; Here, type declares the base type of the array ... store the account numbers of the active users on a network Another array might store the current batting averages for a baseball team When computing the average of a list of values, you will often...
Ngày tải lên: 27/01/2014, 02:20
Graph drawing aesthetics and the comprehension of UML class diagrams: an empirical study pptx
... experimental diagrams) were presented first The data from these diagrams was not collected, and the subjects were not aware that these diagrams were not part of the experiment These diagrams gave the ... diagram The layouts of the false diagrams were visually comparable to those of the correct diagrams: as we did not intend to analyse the responses to the incorrect diagrams, their layout was ... diagram was produced for each aesthetic As the analysis was to be done with respect to the variations within the aesthetics, it was not necessary to use the same middle-effect diagram for all the...
Ngày tải lên: 07/03/2014, 17:20
drawing cartoons and comics for dummies (isbn - 0470426837)
... strips One main advantage is that they’re marketable to publications and Web sites that want a lighthearted, joke -of- the- day feature that a strip with characters may not fulfill Gag cartoons tend ... Watergate scandal — and up to the scathing criticisms of the war in Iraq — editorial cartoons have played and continue to play an important role in the annals of political discourse Editorial cartoons ... the Association of American Editorial Cartoonists, and the Charles Schulz Award, given by the Scripps Howard Foundation Brian is also the two-time winner of the Society of Professional Journalists...
Ngày tải lên: 07/04/2014, 15:46
scientific american - 2003 11 - strings and spacetime with 11 dimensions
... AMERICAN COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC 43 AT AT COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC TGGGATAGCGACGAGCCAGTCTGCTCTAGACAGACGTAGCATATGGGATAGCGACAGACAGACGTAGCATATGGGAG FLECKS OF DARK BROWN ... PLANNING: Laura Salant PROMOTION MANAGER: Diane Schube RESEARCH MANAGER: Aida Dadurian PROMOTION DESIGN MANAGER: Nancy Mongelli GENERAL MANAGER: Michael Florek BUSINESS MANAGER: Marie Maher MANAGER, ... affect inheritance, development and disease The Unseen JAMIE KRIPKE Genome: Gems among the Junk BY W WAYT GIBBS TGGGATAGCGACGAGCCAGTCTGCTCTAGACAGACGTAGCATATGGGATAGCGACGAGCCAGTCTGCTCTAGACAGT COPYRIGHT...
Ngày tải lên: 12/05/2014, 16:18
Drawing Quick and Easy Cartoon Frogs ppt
... across the vertical center of the oval, you're going to draw two very small circles, far apart so that they are closer to the sides of the oval than each other You can offset them a bit to make ... closely at the drawing I think you'll find that it's not hard at all Step Four: The Face Okay, if you thought the body for cartoon frogs was easy, wait till you hear about the face! Are you ready? ... be backward, and the "long" part of the L will almost touch the outsides of the "A" you drew Then, the bottom of the L will be long, and should point in towards the center Step Three: The Cartoon...
Ngày tải lên: 28/06/2014, 18:20
Learn About Drawing Lips and the Mouth potx
... look at the bone structure that makes up the mouth The Jaw and Teeth The jaw is the only bone in the head that actually moves It attaches to the rest of the head just in front of the lower part of ... draw a curve and cur away a small part of it with another curve This time the main curve will be 'U' shaped, and the small part to cut will be the upside down 'U' That's it for the basic shape ... of the ear The 'U' shape of the jaw can be compared to a horseshoe The teeth also fit this 'U' shape and it is important to remember this when drawing lips and the mouth at all times If you have...
Ngày tải lên: 28/06/2014, 21:20
Rose Drawing Lesson and Advice potx
... steps of the drawing we'll start to add more layers of petals as they have wrapped around the middle Step Two – Basic Forms First, add a small circle on top of the shape we drew in the last step ... shapes, there is two larger petals to add to the outside of the shapes Step – Petal Details Add a simple curved line in the middle of the leaves along the stem of the rose Next go to the petals ... carefully than the smaller thorns or your design of your rose drawing may look off balance Next, start drawing the petals that wrap around the middle circle that we drew in the first step If you can think...
Ngày tải lên: 28/06/2014, 21:20
Drawing Hands and Feet pot
... How to draw hands ? How to draw feet ? ...
Ngày tải lên: 29/06/2014, 00:20
báo cáo khoa học: " Comparative analysis of the complete sequence of the plastid genome of Parthenium argentatum and identification of DNA barcodes to differentiate Parthenium species and lines" pdf
... matK, matK-F, 5'-GAATTTCAAATGGAGAATTCCAAAGC-3' and matK-end-R, 5'CGAGCTAAAGTTCTAGCACAAGAAAGTCG-3'; and for psbA-trnH, psbA-F, 5'-GGAAGTTATGCATGAACGTAATGCTC-3' and trnH-R, 5'-CGCGCATGGTGGATTCACAA ... 5'-CGAGTTGGGGATAGAGGGACTTGAAC-3' and TrnL-R, 5'-GATATGGCGAAATAGGTAGACGCTACGGAC-3' were used to amplify trnL-UAA; for rpoC, rpoC1-F, 5'-CATAGGAGTTGCTAAGAGTCAAATTCGG-3' and rpoC2-R, 5'-CCTTTTCTAGATCTTGATTCA CGTAGAAATTCCGC-3'; ... argentatum AZ101 75 86 argentatum AZ1 argentatum AZ2 argentatum AZ3 argentatum AZ4 argentatum AZ5 argentatum AZ6 argentatum Cal6 argentatum 11591 06i, 0830 argentatum 11591 argentatum C-156 argentatum...
Ngày tải lên: 12/08/2014, 03:21
Pointers. Arrays. Strings. Searching and sorting algorithms.
... far-away elements against each other before comparing closer-together elements The distance between elements is called the “gap” In the shell sort, the array is sorted by sorting gap sub-arrays, ... first character that is not a delimiter), and finding the end of the token (the next character that is a delimiter) The first call of strtok() looks like this: char ∗ strtok(char ∗ str, const char ∗ ... knowledge of strings to duplicate the functionality of the C standard library’s strtok() function, which extracts “tokens” from a string The string is split using a set of delimiters, such as whitespace...
Ngày tải lên: 25/04/2013, 08:07